ChrX-STR.org 2.0
Database and information hub for forensic X-chromosomal markers

Marker GATA144D04

Create date:	Jun 25, 2009 12:18:12 PM
Last update:	Jul 3, 2012 12:00:00 AM

Cytogenetic localisation:	p 11.23
Physical localisation NCBI 36:	44.898
Genetic localisation deCODE:	69.87
Rutgers Map v.2:	78.96

Reference:	Ying BW, Shi MS, Deng JQ, Hou YP, Yan J, Li YB, Wu J, Zhang J, Lin W (2003) Chi...

Primer

PrimerF:

5' -

FAM-AAGATCTGCCAAGCCAGAAG

- 3'

PrimerR:

5' -

CTTGCAGTGAGGGACAGAGA

- 3'

Typical structure

Allele	bps	Sequence composition
9	-	(CTAT))
10	-	(CTAT)10
11	-	(CTAT)11
12	-	(CTAT)9 CTGT(CTAT)2
13	-	(CTAT)10 CTGT(CTAT)2
14	-	(CTAT)11 CTGT(CTAT)2
15	-	(CTAT)12 CTGT(CTAT)2
16	-	(CTAT)13 CTGT(CTAT)2

References:

Hering S, Edelmann J, Augustin C, Szibor R, Immel UD. Chromosome X markers DXS6...

Cell line DNA	Allele
K562	13
NA9948	13

References:

Hering S, Edelmann J, Augustin C, Szibor R, Immel UD. Chromosome X markers DXS6...

Population data

The values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.

ID	Population	Reference	PIC	HET	MEC Krüger	MEC Kishida	MEC Desmarais	MEC Desmarais duo	PD female	PD male
1	Germany	Hering ...	0.7131	0.7518	0.5318	0.7131	0.7131	0.5769	0.8997	0.7518
2	Germany	Hering ...	0.6927	0.7312	0.5103	0.6929	0.6927	0.5534	0.8893	0.7312
3	Germany	Hering ...	0.7013	0.7397	0.5193	0.7013	0.7013	0.5632	0.8939	0.7397

ID	Population	Ethnic specification	Reference	n*	9	10	11	12	13	14	15	16
1	Germany	German	Hering ...	161 males	0.0125	0.0375	0.0375	0.2125	0.3562	0.2625	0.0625	0.0188
2	Germany	Germans	Hering ...	362 females	0.0055	0.0359	0.0249	0.2348	0.4144	0.1851	0.0691	0.0304
3	Germany	German	Hering ...	523 both	0.0077	0.0364	0.0287	0.2280	0.3966	0.2088	0.0670	0.0268

n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.

References

No reference data.

Note

No data.

Manage

Manage access

News

Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.

Data Protection | Imprint |