|
Marker DXS9895
| Create date: |
Jun 25, 2009 12:18:11 PM |
| Last update: |
Jun 25, 2009 12:23:59 PM |
 |
|
| Cytogenetic localisation: |
p 22.32 |
| Physical localisation NCBI 36: |
7.387 |
| Genetic localisation deCODE: |
14.40 |
| Rutgers Map v.2: |
17.09 |
|
|
| Reference: |
Edelmann J, Hering, S, Michael, M, Lessig, R, Deichsel, D, Meier-Sundhausen, G,... |
Primer
| PrimerF: |
5' - |
TTGGGTGGGGACACAGAG |
- 3' |
| PrimerR: |
5' - |
CCTGGCTCAAGGAATTACAA |
- 3' |
Typical structure| 11-18 | 135-163 | PF-N12-(AGAT)9-A-(AGAT)3-N40-PR, PF-N12-(AGAT)10-A-(AGAT)3-N40-PR, PF-N12-(AGAT)11-A-(AGAT)3-N40-PR, PF-N12-(AGAT)12-A-(AGAT)3-N40-PR, PF-N12-(AGAT)3-AT-(AGAT)9-A-(AGAT)3-N40-PR, PF-N12-(AGAT)13-A-(AGAT)3-N40-PR 9, PF-N12-(AGAT)3-AT-(AGAT)10-A (AGAT)3-N40-PR, PF-N12-(AGAT)14-A-(AGAT)3-N40-PR 5, PF-N12-(AGAT)3-AT-(AGAT)11-A-(AGAT)3-N40-PR |
| Comment: |
PF: sequence of primer PF (18 bp), PR: complementary sequence of primer PR (20 bp), N12: CCAAACCATATC, N40: AGAATGAATATATAGACACAGGTAAATTTTCATTTTTTAT (differences to GDB sequence are underlined). |
| K562 (BRL) | 16 | | K562 (Promega) | 16 | | NA3657 | 15 | | NA9947A | 13, 17 | | NA9948 | 13 |
Population dataThe values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.| 1 | China (Wuhan) | Huang D... | 0.6883 | 0.7361 | 0.4912 | 0.6883 | 0.6883 | 0.5470 | 0.8825 | 0.7361 | | 2 | Germany | Edelman... | 0.6940 | 0.7404 | 0.4992 | 0.6940 | 0.6940 | 0.5537 | 0.8862 | 0.7404 | | 3 | Korea | Shin SH... | 0.7056 | 0.7502 | 0.5120 | 0.7056 | 0.7056 | 0.5663 | 0.8931 | 0.7502 | | 4 | Taiwan | Chen MY... | 0.6730 | 0.7214 | 0.4772 | 0.6742 | 0.6730 | 0.5302 | 0.8740 | 0.7214 |
| 1 |
China (Wuhan) |
Asian (Chinese Han) |
Huang D... |
292 |
|
0.0020 |
0.3060 |
0.3100 |
0.2450 |
|
0.1180 |
|
0.0130 |
|
0.0060 |
| 2 |
Germany |
Caucasian (European) |
Edelman... |
566 |
|
0.0010 |
0.3060 |
0.3040 |
0.2440 |
0.0010 |
0.1170 |
0.0100 |
0.0150 |
0.0020 |
|
| 3 |
Korea |
Asian (Korean) |
Shin SH... |
401 |
|
0.0040 |
0.2880 |
0.2930 |
0.2340 |
|
0.1610 |
|
0.0190 |
|
0.0010 |
| 4 |
Taiwan |
all |
Chen MY... |
413 |
0.0020 |
0.0020 |
0.2860 |
0.3800 |
0.1970 |
|
0.1150 |
|
0.0190 |
|
|
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.
References
- Asamura H, Sakai H, Kobayashi K, Ota M, Fukushima H (2006) MiniX-STR multiplex system population st...
- Asamura H, Sakai H, Ota M, Fukushima H (2006) Japanese population data for eight X-STR loci using t...
- Chen MY, Pu CE (2004) Population data on the X chromosome short tandem repeat loci DXS10011, DXS101...
- Edelmann J, Deichsel D, Hering S, Plate I, Szibor R (2002) Sequence variation and allele nomenclatu...
- Edelmann J, Szibor R (2003) The X-linked STRs DXS7130 and DXS6803. Forensic Science International 1...
- Huang DX, Yang QG, Yu CY, Yang RZ (2003) Development of the X-linked tetrameric microsatellite mark...
- Rodrigues EMR, Leite FPDN, Hutz MH, Palha TDBF, dos Santos AKCR, dos Santos SEB (2008) A multiplex ...
- Shin SH, Yu JS, Park SW, Min GS, Chung KW (2005) Genetic analysis of 18 X-linked short tandem repea...
- Son JY, Lee YS, Choung CM, Lee SD (2002) Polymorphism of nine X chromosomal STR loci in Koreans. In...
- Szibor R (2007) X-chromosomal markers: past, present and future. Forensic Sci Int Genet 1:93-99
- Szibor R, Edelmann J, Hering S, Plate I, Wittig H, Roewer L, Wiegand P, Cali F, Romano V, Michael M...
- Szibor R, Krawczak M, Hering S, Edelmann J, Kuhlisch E, Krause D (2003) Use of X-linked markers for...
- Zarrabeitia MT, Alonso A, Martin J, Gonzalez-Gay MA, Martin-Escudero JC, de Pancorbo MM, Sanz P, Ru...
NoteNo data.
|
 |
News
Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.
|
|
