ChrX-STR.org 2.0
Database and information hub for forensic X-chromosomal markers
Home
Content
Marker
Haplotypes
Evaluate & Calculate
Submit Data
Software and Kits
Literature
Links

Marker DXS6789

Create date: Jun 25, 2009 12:18:13 PM
Last update: Sep 27, 2010 1:56:09 PM
Cytogenetic localisation: q 21.33
Physical localisation NCBI 36: 95.336
Genetic localisation deCODE: 96.95
Rutgers Map v.2: 108.47
Reference: Hering S, Kuhlisch E, Szibor R (2001) Development of the X-linked tetrameric mi...

Primer

PrimerF: 5' - GTTGGTACTTAATAAACCCTCTTT - 3'
PrimerR: 5' - AAGAAGTTATTTGATGTCCTATTGT - 3'
Comment: When the promised primers are used alleles 14-25 exhibit 154-198 bps.

Typical structure

No repeat structure data.

Cell line DNAAllele
K562 (BRL)21
K562 (Promega)21
NA365723
NA9947A21, 22
NA994820
References: Szibor R, Edelmann J, Hering S, Plate I, Wittig H, Roewer L, Wiegand P, Cali F,...
Hering S, Kuhlisch E, Szibor R (2001) Development of the X-linked tetrameric mi...

Population data

The values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.
IDPopulationReferencePICHETMEC KrügerMEC KishidaMEC DesmaraisMEC Desmarais duoPD femalePD male
1Belo Horizonte, BrazilGenetic...0.78610.80990.63320.78570.78610.66570.94010.8099
2GermanyTabbada...0.70390.73940.53000.70420.70390.56770.89660.7394
3Germany (East)Hering ...0.69220.73520.50500.69220.69220.55300.88690.7352
4Germany (East)Hering ...0.70470.74330.52420.70470.70470.56760.89550.7433
5Germany (East)Hering ...0.70160.74130.51940.70160.70160.56390.89330.7413
6KoreaShin SH...0.78960.81440.63430.78850.78960.66960.94080.8144
7PhilippineTabbada...0.71200.74780.53390.71220.71200.57550.90060.7478
8Portugal (North)Pereira...0.69350.72830.51600.69370.69350.55450.89140.7283
9Rio de Janeiro, BrazilGenetic...0.77900.80520.62190.77900.77900.65660.93590.8052
10Spain (Valencia)Aler M,...0.70540.74420.52320.70530.70540.56790.89580.7442
11São Paulo, BrazilGenetic...0.78800.81220.63480.78790.78800.66780.94050.8122
12TaiwanChen MY...0.74990.77940.58500.75110.74990.62070.92190.7794
13Vitória, BrazilGenetic...0.75760.78570.59500.75760.75760.63030.92590.7857
ID Population Ethnic specification Reference n* 13 14 15 16 17 18 19 20 21 22 23 24 25 26
1 Belo Horizonte, Brazil admixed Genetic... 245 0.0028 0.1217 0.0680 0.0058 0.0084 0.0426 0.3114 0.2209 0.1302 0.0766 0.0112
2 Germany Caucasian (European) Tabbada... 105 0.0063 0.0563 0.0375 0.0438 0.4000 0.2875 0.0875 0.0563 0.0250
3 Germany (East) Caucasian (European) Hering ... 250 males 0.0040 0.0400 0.0120 0.0400 0.3680 0.2920 0.1960 0.0480
4 Germany (East) Caucasian (European) Hering ... 315 females 0.0020 0.0350 0.0140 0.0020 0.0030 0.0250 0.3760 0.2840 0.1650 0.0700 0.0220 0.0020
5 Germany (East) Caucasian (European) Hering ... 565 0.0020 0.0360 0.0140 0.0010 0.0020 0.0300 0.3740 0.2860 0.1740 0.0640 0.0160 0.0010
6 Korea Asian (Korean) Shin SH... 401 0.0040 0.0010 0.1510 0.2820 0.0410 0.0380 0.1850 0.2000 0.0750 0.0160 0.0050 0.0010
7 Philippine Asian Tabbada... 115 0.2254 0.3931 0.0867 0.0173 0.1908 0.0405 0.0289 0.0116 0.0058
8 Portugal (North) all Pereira... 347 males 0.0519 0.0231 0.0202 0.4352 0.2305 0.1354 0.0836 0.0144 0.0029 0.0029
9 Rio de Janeiro, Brazil admixed Genetic... 261 0.0074 0.1034 0.0616 0.0025 0.0049 0.0493 0.2906 0.2438 0.1773 0.0493 0.0074 0.0025
10 Spain (Valencia) all Aler M,... 145 females 0.0069 0.0172 0.0172 0.0034 0.0345 0.3828 0.2241 0.2276 0.0724 0.0138
11 São Paulo, Brazil admixed Genetic... 250 0.0121 0.0821 0.1376 0.0097 0.0048 0.0362 0.3019 0.2005 0.1667 0.0362 0.0121
12 Taiwan all Chen MY... 447 0.0050 0.1680 0.3540 0.0570 0.0330 0.2270 0.0930 0.0480 0.0160
13 Vitória, Brazil admixed Genetic... 245 0.0074 0.1012 0.0568 0.0025 0.0049 0.0593 0.3407 0.2494 0.1309 0.0420 0.0049
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.

References

Note

No data.

News

Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.
Data Protection | Imprint |