|
Marker DXS6807
Primer
| PrimerF: |
5' - |
GAGCAATGATCTCATTTGCA |
- 3' |

| PrimerR: |
5' - |
AAGTAAACATGTATAGGAAAAAGCT |
- 3' |
Typical structure| 11-17 | 251-275 | Pr.1-N149 -(GATA)1 - GTAATGA - (GATA)2 - GAC - (GATA)8-14 - TGT - Pr.2 |
| K562 (BRL) | 11 | | K562 (Promega) | 11 | | NA3657 | 15 | | NA9947A | 12, 14 | | NA9948 | 11 |
Population dataThe values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.| 1 | Germany | Edelman... | 0.6132 | 0.6665 | 0.4137 | 0.6132 | 0.6132 | 0.4662 | 0.8355 | 0.6665 | | 2 | Germany | Edelman... | 0.6053 | 0.6575 | 0.4074 | 0.6053 | 0.6053 | 0.4579 | 0.8305 | 0.6575 | | 3 | Germany (North East) | Poetsch... | 0.6364 | 0.6890 | 0.4382 | 0.6376 | 0.6364 | 0.4910 | 0.8506 | 0.6890 | | 4 | Korea | Shin SH... | 0.6236 | 0.6824 | 0.4230 | 0.6248 | 0.6236 | 0.4785 | 0.8403 | 0.6824 |
| 1 |
Germany |
Caucasian (European) |
Edelman... |
308 females |
|
0.4790 |
0.0230 |
0.0100 |
0.2350 |
0.2180 |
0.0240 |
0.0110 |
|
|
| 2 |
Germany |
Caucasian (European) |
Edelman... |
517 |
|
0.4960 |
0.0220 |
0.0110 |
0.2340 |
0.2010 |
0.0250 |
0.0110 |
|
|
| 3 |
Germany (North East) |
Caucasian (European) |
Poetsch... |
205 |
|
0.4390 |
0.0070 |
0.0230 |
0.2560 |
0.2260 |
0.0300 |
0.0100 |
0.0070 |
0.0030 |
| 4 |
Korea |
Asian (Korean) |
Shin SH... |
401 |
0.0040 |
0.3870 |
0.0180 |
0.0250 |
0.3700 |
0.1720 |
0.0190 |
0.0060 |
|
|
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.
References
- Asamura H, Sakai H, Ota M, Fukushima H (2006) Japanese population data for eight X-STR loci using t...
- Bini C, Ceccardi S, Ferri G, Pelotti S, Alu M, Roncaglia E, Beduschi G, Caenazzo L, Ponzano E, Tasi...
- Buekers TE, Lallas TA, Buller RE (2000) Xp22.2-3 loss of heterozygosity is associated with germline...
- Edelmann J, Hering, S, Michael, M, Lessig, R, Deichsel, D, Meier-Sundhausen, G, Roewer, L, Plate, I...
- Hering S, Kuhlisch E, Szibor R (2001) Development of the X-linked tetrameric microsatellite marker ...
- Jawaheer D, Seldin MF, Amos CI, Chen WV, Shigeta R, Monteiro J, Kern M, Criswell LA, Albani S, Nels...
- Moreno MA, Builes JJ, Jaramillo P, Espinal C, Aguirre D, Bravo ML (2005) Allele frequency distribut...
- Pelotti S, Bini C, Ceccardi S, Ferri G, Abbondanza A, Greggio NA, Ponzano E, Caenazzo L (2003) Sex ...
- Poetsch M, El-Mostaqim D, Tschentscher F, Browne E, Timmann C, Horstmann R, von Wurmb-Schwark N (20...
- Poetsch M, Petersmann H, Repenning A, Lignitz E (2005) Development of two pentaplex systems with X-...
- Poetsch M, Sabule A, Petersmann H, Volksone V, Lignitz E (2006) Population data of 10 X-chromosomal...
- Shi MS, Deng JQ, Ying BW, Hou YP, Yan J, Li YB, Wu J, Tang JP, Ji Q (2003) Two X-chromosome STR loc...
- Shin SH, Yu JS, Park SW, Min GS, Chung KW (2005) Genetic analysis of 18 X-linked short tandem repea...
- Sood AK, Holmes R, Hendrix MJC, Buller RE (2001) Application of the National Cancer Institute inter...
- Szibor R (2007) X-chromosomal markers: past, present and future. Forensic Sci Int Genet 1:93-99
- Szibor R, Edelmann J, Hering S, Plate I, Wittig H, Roewer L, Wiegand P, Cali F, Romano V, Michael M...
- Turrina S, Atzei R, Filippini G, De Leo D (2007) Development and forensic validation of a new multi...
- Edelmann J, Lessig R, Hering S, Horn LC (2004) Loss of heterozygosity and microsatellite instabilit...
NoteNo data.
|
 |

News
Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.
|
 |