ChrX-STR.org 2.0
This database covers many issues concerning the usage of X-chromosomal markers for forensic purpose



Marker DXS6795

Create date: Jun 25, 2009 12:18:12 PM
Last update: Jun 20, 2012 12:00:00 AM
Cytogenetic localisation: p 22.11
Physical localisation NCBI 36: 23.254
Rutgers Map v.2: 44.24
Reference: Son, J.Y., Lee, Y.S., Choung, C.M., and Lee, S.D. 2002, Polymorphism of nine X ...

Primer

PrimerF: 5' - FAM-CTGGTCCAACTGATGCACAC - 3'
PrimerR: 5' - GAAATGCATCCATCCCCTAA - 3'

Typical structure

AllelebpsSequence composition
9-(AAT)7 GATAAT
10-(AAT)10
11-(AAT)11
12-(AAT)12
13-(AAT)13
14-(AAT)14
References: 24th World Congress of the International Society for Forensic Genetics August 2...
Hering S, Edelmann J, Augustin C, Szibor R, Immel DU. Chromosome X markers DXS6...

Cell line DNAAllele
K5629
NA994811
References: 24th World Congress of the International Society for Forensic Genetics August 2...
Hering S, Edelmann J, Augustin C, Szibor R, Immel DU. Chromosome X markers DXS6...

Population data

The values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.
IDPopulationReferencePICHETMEC KrügerMEC KishidaMEC DesmaraisMEC Desmarais duoPD femalePD male
1GermanyHering ...0.62680.68450.42390.62670.62680.48120.84270.6845
2GermanyHering ...0.59610.65730.39310.59600.59610.44960.82140.6573
3GermanyHering ...0.60660.66660.40380.60660.60660.46030.82880.6666
ID Population Ethnic specification Reference n* 9 10 11 12 13 14
1 Germany German Hering ... 161 males 0.3354 0.0062 0.4099 0.0683 0.1739 0.0062
2 Germany German Hering ... 362 females 0.3202 0.0140 0.4607 0.0337 0.1629 0.0084
3 Germany German Hering ... 523 0.3250 0.0116 0.4449 0.0445 0.1663 0.0077
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.

References

Note

No data.

News

Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.