|
Marker DXS6795
Create date: |
Jun 25, 2009 12:18:12 PM |
Last update: |
Jun 20, 2012 12:00:00 AM |
|
|
Cytogenetic localisation: |
p 22.11 |
Physical localisation NCBI 36: |
23.254 |
Rutgers Map v.2: |
44.24 |
|
|
Reference: |
Son, J.Y., Lee, Y.S., Choung, C.M., and Lee, S.D. 2002, Polymorphism of nine X ... |
Primer
PrimerF: |
5' - |
FAM-CTGGTCCAACTGATGCACAC |
- 3' |
PrimerR: |
5' - |
GAAATGCATCCATCCCCTAA |
- 3' |
Typical structure9 | - | (AAT)7 GATAAT | 10 | - | (AAT)10 | 11 | - | (AAT)11 | 12 | - | (AAT)12 | 13 | - | (AAT)13 | 14 | - | (AAT)14 |
References: |
24th World Congress of the International Society for Forensic Genetics August 2...
Hering S, Edelmann J, Augustin C, Szibor R, Immel DU. Chromosome X markers DXS6...
|
References: |
Hering S, Edelmann J, Augustin C, Szibor R, Immel DU. Chromosome X markers DXS6...
24th World Congress of the International Society for Forensic Genetics August 2...
|
Population dataThe values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.1 | Germany | Hering ... | 0.6268 | 0.6845 | 0.4239 | 0.6267 | 0.6268 | 0.4812 | 0.8427 | 0.6845 | 2 | Germany | Hering ... | 0.5961 | 0.6573 | 0.3931 | 0.5960 | 0.5961 | 0.4496 | 0.8214 | 0.6573 | 3 | Germany | Hering ... | 0.6066 | 0.6666 | 0.4038 | 0.6066 | 0.6066 | 0.4603 | 0.8288 | 0.6666 |
1 |
Germany |
German |
Hering ... |
161 males |
0.3354 |
0.0062 |
0.4099 |
0.0683 |
0.1739 |
0.0062 |
2 |
Germany |
German |
Hering ... |
362 females |
0.3202 |
0.0140 |
0.4607 |
0.0337 |
0.1629 |
0.0084 |
3 |
Germany |
German |
Hering ... |
523 |
0.3250 |
0.0116 |
0.4449 |
0.0445 |
0.1663 |
0.0077 |
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.
References
- Hering S, Edelmann J, Augustin C, Kuhlisch E, Szibor R. X chromosomal recombination—a family study ...
- Son JY, Lee YS, Choung CM, Lee SD. Polymorphism of nine X chromosomal STR loci in Koreans. Int J Le...
- 24th World Congress of the International Society for Forensic Genetics August 29–September 3, 2011 ...
- Hering S, Edelmann J, Augustin C, Szibor R, Immel DU. Chromosome X markers DXS6795, DXS9907 and GAT...
NoteNo data.
|
|
News
Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.
|
|