|
Marker GATA172D05
Create date: |
Jun 25, 2009 12:18:14 PM |
Last update: |
Sep 27, 2010 1:56:09 PM |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif) |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif) |
Cytogenetic localisation: |
q 23.00 |
Physical localisation NCBI 36: |
113.061 |
Genetic localisation deCODE: |
110.42 |
Rutgers Map v.2: |
124.36 |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif) |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif) |
Reference: |
Edelmann J, Hering, S, Michael, M, Lessig, R, Deichsel, D, Meier-Sundhausen, G,... |
Primer
PrimerF: |
5' - |
TAGTGGTGATGGTTGCACAG |
- 3' |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif)
PrimerR: |
5' - |
ATAATTGAAAGCCCGGATTC |
- 3' |
Typical structure5-12 | 104-132 | PF-N5-(TAGA)5-12 N39-PR |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif)
Comment: |
PF: sequence of primer PF (20 bp), PR: complementary sequence of primer PR (20 bp), N5: ATATA, N39: GCTATATCAATACCTATATCTATAGATATAGATCTTTTT (differences to GDB sequence are underlined) |
K562 (BRL) | 12 | K562 (Promega) | 12 | NA3657 | 9 | NA9947A | 10, 10 | NA9948 | 6 |
Population dataThe values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.1 | Belo Horizonte, Brazil | Genetic... | 0.8138 | 0.8356 | 0.6680 | 0.8138 | 0.8138 | 0.7001 | 0.9512 | 0.8356 | 2 | Germany | Edelman... | 0.7753 | 0.8037 | 0.6119 | 0.7753 | 0.7753 | 0.6506 | 0.9331 | 0.8037 | 3 | Korea | Shin KJ... | 0.7143 | 0.7484 | 0.5374 | 0.7143 | 0.7143 | 0.5778 | 0.9026 | 0.7484 | 4 | Korea | Shin SH... | 0.7023 | 0.7356 | 0.5240 | 0.7011 | 0.7023 | 0.5638 | 0.8968 | 0.7356 | 5 | Portugal (North) | Pereira... | 0.7503 | 0.7829 | 0.5771 | 0.7502 | 0.7503 | 0.6198 | 0.9203 | 0.7829 | 6 | Rio de Janeiro, Brazil | Genetic... | 0.7833 | 0.8105 | 0.6223 | 0.7833 | 0.7833 | 0.6604 | 0.9369 | 0.8105 | 7 | Spain (Valencia) | Aler M,... | 0.7839 | 0.8112 | 0.6228 | 0.7838 | 0.7839 | 0.6611 | 0.9371 | 0.8112 | 8 | São Paulo, Brazil | Genetic... | 0.7879 | 0.8137 | 0.6305 | 0.7879 | 0.7879 | 0.6666 | 0.9395 | 0.8137 | 9 | Vitória, Brazil | Genetic... | 0.7911 | 0.8154 | 0.6369 | 0.7911 | 0.7911 | 0.6710 | 0.9417 | 0.8154 |
1 |
Belo Horizonte, Brazil |
admixed |
Genetic... |
245 |
|
0.1530 |
0.0369 |
0.1246 |
0.1842 |
0.2068 |
0.1953 |
0.0964 |
0.0028 |
2 |
Germany |
Caucasian (European) |
Edelman... |
503 |
0.1420 |
0.0030 |
0.1730 |
0.0600 |
0.2730 |
0.2370 |
0.1090 |
0.0030 |
|
3 |
Korea |
Asian (Korean) |
Shin KJ... |
300 |
|
0.0800 |
0.0040 |
0.1560 |
0.0870 |
0.4020 |
0.2220 |
0.0490 |
|
4 |
Korea |
Asian (Korean) |
Shin SH... |
401 |
|
0.0650 |
0.0040 |
0.1380 |
0.1000 |
0.4300 |
0.2080 |
0.0540 |
|
5 |
Portugal (North) |
all |
Pereira... |
347 males |
|
0.2017 |
0.0029 |
0.1671 |
0.0375 |
0.3199 |
0.1988 |
0.0720 |
|
6 |
Rio de Janeiro, Brazil |
admixed |
Genetic... |
261 |
|
0.1896 |
0.0222 |
0.1724 |
0.1576 |
0.2685 |
0.1601 |
0.0271 |
0.0025 |
7 |
Spain (Valencia) |
all |
Aler M,... |
145 females |
|
0.1931 |
0.0034 |
0.1586 |
0.0655 |
0.2517 |
0.2138 |
0.1138 |
|
8 |
São Paulo, Brazil |
admixed |
Genetic... |
250 |
|
0.1473 |
0.0168 |
0.1546 |
0.1256 |
0.2730 |
0.2126 |
0.0701 |
|
9 |
Vitória, Brazil |
admixed |
Genetic... |
245 |
|
0.1481 |
0.0272 |
0.1531 |
0.1407 |
0.2963 |
0.1605 |
0.0716 |
0.0025 |
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.
References
- Aler A, Sanchez-Diz P, Gomes I, Gisbert M, Carracedo A, Amorim A, Gusmao L (2007) Genetic data of 1...
- Asamura H, Sakai H, Kobayashi K, Ota M, Fukushima H (2006) MiniX-STR multiplex system population st...
- Asamura H, Sakai H, Ota M, Fukushima H (2006) Japanese population data for eight X-STR loci using t...
- Cui B, Zhang HB, Lu YZ, Zhong W, Pei G, Kong XY, Hu LD (2004) Refinement of the locus for non-syndr...
- Edelmann J, Deichsel D, Hering S, Plate I, Szibor R (2002) Sequence variation and allele nomenclatu...
- Ehm MG, Karnoub MC, Sakul H, Gottschalk K, Holt DC, Weber JL, Vaske D, Briley D, Briley L, McMillen...
- Gomes I, Alves C, Maxzud K, Pereira R, Prata MJ, Sanchez-Diz P, Carracedo A, Amorim A, Gusmao L (20...
- Gomes I, Prinz M, Pereira R, Meyers C, Mikulasovich RS, Amorim A, Carracedo A, Gusmao L (2007) Gene...
- Justice CM, Miller NH, Marosy B, Zhang J, Wilson AF (2003) Familial idiopathic scoliosis - Evidence...
- Kerrison JB, Vagefi MR, Barmada MM, Maumenee LH (1999) Congenital motor nystagmus linked to Xq26-q2...
- Lee HY, Park MJ, Jeong CK, Lee SY, Yoo JE, Chung U, Choi JH, Kim CY, Shin KJ (2004) Genetic charact...
- Pereira R, Gomes I, Amorim A, Gusmao L (2007) Genetic diversity of 10 X chromosome STRs in northern...
- Pico A, Castillo A, Vargas C, Amorim A, Gusmao L (2008) Genetic profile characterization and segreg...
- Poetsch M, Petersmann H, Repenning A, Lignitz E (2005) Development of two pentaplex systems with X-...
- Robino C, Giolitti A, Gino S, Torre C (2006) Development of two multiplex PCR systems for the analy...
- Rodrigues EMR, dos Santos NPC, dos Santos AKCR, Marinho AN, Zago MA, Gomes I, Amorim A, Gusmao L, d...
- Shin KJ, Kwon BK, Lee SS, Yoo JE, Park MJ, Chung U, Lee HY, Han GR, Choi JH, Kim CY (2004) Five hig...
- Shin SH, Yu JS, Park SW, Min GS, Chung KW (2005) Genetic analysis of 18 X-linked short tandem repea...
- Szibor R (2007) X-chromosomal markers: past, present and future. Forensic Sci Int Genet 1:93-99
- Szibor R, Edelmann J, Hering S, Plate I, Wittig H, Roewer L, Wiegand P, Cali F, Romano V, Michael M...
- Szibor R, Krawczak M, Hering S, Edelmann J, Kuhlisch E, Krause D (2003) Use of X-linked markers for...
- Tariq MA, Ullah O, Riazuddin SA, Riazuddin S (2008) Allele frequency distribution of 13 X-chromosom...
- Turrina S, De Leo D (2003) Population data of three X-chromosomal STRs: DXS7132, DXS7133 and GATA17...
- Zarrabeitia MT, Alonso A, Martin J, Gonzalez-Gay MA, Martin-Escudero JC, de Pancorbo MM, Sanz P, Ru...
- Zarrabeitia MT, Alonso A, Zarrabeitia AL, Blanco L, Riancho JA (2005) Unlinked tetrameric microsate...
- Edelmann J, Lessig R, Hering S, Horn LC (2004) Loss of heterozygosity and microsatellite instabilit...
- Lee KL, Han MS, Jo BH, Park SW, Heo KB, Chung KW (2008) Development of two hexaplex systems with X-...
- Turrina S, De Leo D (2004) Population genetic comparisons of three X-chromosomal STRs (DXS7132, DXS...
NoteNo data.
|
![](/xdb/skins/img/ajaxProcess.gif;jsessionid=7CCEA15B3E4DDF09CFC351853708EFB2) |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif)
News
Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.
|
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif) |