|
Marker DXS10074
Primer
PrimerF: |
5' - |
TAGGCGCTTCCTAGACCTCA |
- 3' |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif)
PrimerR: |
5' - |
CCTTCCTTCCCATGTTCTCA |
- 3' |
Typical structure13-21 | 195-227 | (AAGA)10-18 AAGG (AAGA)2 | 16.2 | 209 | AA (AAGA)13 AAGG (AAGA)2 | 7-10 | 165-177 | (AAGA)7-10 |
9947A (Promega) | 16-19 | K562 (Promega, Gibco) | 17 | NA 3567 (Coriell) | 7 | NA 9948 (Coriell) | 18 |
Population dataThe values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.1 | China (Guangdong) | Genetic... | 0.7341 | 0.7695 | 0.5575 | 0.7341 | 0.7341 | 0.6010 | 0.9115 | 0.7695 | 2 | Germany | Becker ... | 0.8128 | 0.8326 | 0.6717 | 0.8122 | 0.8128 | 0.7004 | 0.9521 | 0.8326 | 3 | Germany | Becker ... | 0.8204 | 0.8400 | 0.6810 | 0.8201 | 0.8204 | 0.7100 | 0.9548 | 0.8400 | 4 | Germany | Becker ... | 0.8176 | 0.8372 | 0.6780 | 0.8171 | 0.8176 | 0.7066 | 0.9539 | 0.8372 | 5 | Ghana | Becker ... | 0.8556 | 0.8693 | 0.7370 | 0.8553 | 0.8556 | 0.7587 | 0.9692 | 0.8693 | 6 | Japan (Fukuoka) | Becker ... | 0.7357 | 0.7673 | 0.5630 | 0.7357 | 0.7357 | 0.6026 | 0.9142 | 0.7673 |
1 |
China (Guangdong) |
Asian (Chinese Han) |
Genetic... |
272 both |
|
|
|
|
|
|
|
0.0050 |
0.0050 |
0.0575 |
|
0.0025 |
0.1425 |
|
0.3050 |
0.3000 |
0.0025 |
0.1525 |
|
0.0225 |
0.0050 |
2 |
Germany |
Caucasian (European) |
Becker ... |
278 females |
|
0.0866 |
0.1462 |
0.0090 |
|
|
0.0018 |
0.0018 |
0.0162 |
0.0613 |
|
|
0.2725 |
|
0.2111 |
0.1083 |
|
0.0595 |
0.0018 |
0.0162 |
0.0072 |
3 |
Germany |
Caucasian (European) |
Becker ... |
439 males |
|
0.0706 |
0.1435 |
0.0068 |
0.0023 |
|
|
0.0023 |
0.0091 |
0.0728 |
|
|
0.2050 |
0.0023 |
0.2300 |
0.1731 |
|
0.0615 |
|
0.0159 |
0.0045 |
4 |
Germany |
Caucasian (European) |
Becker ... |
717 |
|
0.0813 |
0.1453 |
0.0083 |
0.0007 |
|
0.0012 |
0.0019 |
0.0138 |
0.0652 |
|
|
0.2500 |
0.0007 |
0.2174 |
0.1299 |
|
0.0602 |
0.0012 |
0.0161 |
0.0063 |
5 |
Ghana |
all |
Becker ... |
59 males |
0.0169 |
0.1186 |
0.0169 |
|
|
0.0678 |
0.0847 |
0.1186 |
0.1356 |
0.1695 |
0.0169 |
|
0.2034 |
|
0.0169 |
0.0339 |
|
|
|
|
|
6 |
Japan (Fukuoka) |
Asian (Japanese) |
Becker ... |
93 males |
|
|
|
|
|
|
|
0.0108 |
|
0.1075 |
|
|
0.1828 |
|
0.3763 |
0.1828 |
|
0.1075 |
|
0.0323 |
|
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.
References
Note
|
![](/xdb/skins/img/ajaxProcess.gif;jsessionid=B536A632BC0BAACF51AB7A625845AD46) |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif)
News
Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.
|
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif) |