ChrX-STR.org 2.0
This database covers many issues concerning the usage of X-chromosomal markers for forensic purpose



Marker DXS6801

Create date: Jun 25, 2009 12:18:13 PM
Last update: Jul 6, 2009 8:11:48 AM
Cytogenetic localisation: q 21.32
Physical localisation NCBI 36: 92.378
Rutgers Map v.2: 106.08
Reference: Edelmann J, Szibor R (2005) Validation of the X-linked STR DXS6801. Forensic Sc...

Primer

PrimerF: 5' - CATTTCCTCTAACAAGTCTCC - 3'
PrimerR: 5' - CAGAGAGTCAGAATCAGTAG - 3'

Typical structure

AllelebpsSequence composition
8-14113-137PF–N20–(ATCT)6-12–N7–(ATCT)2–N13–PR
Comment: Allele nomenclature, sequence composition and fragment length of 29 sequenced PCR fragments.  PF1: sequence of primer PF1 (21 bp); PR1: complementary sequence of primer PR1 (20 bp); N20: TTTCACATATCTCTCTTTTC;  N7:ATCAACT; variation in N7 [underlined: sequence variation from A to T is a known SNP (refSNP ID: rs3059016)]
References: Edelmann J, Szibor R (2005) Validation of the X-linked STR DXS6801. Forensic Sc...

Cell line DNAAllele
K562 (BRL)11
NA3657n. d.
NA9947A11, 11
NA994811
References: Edelmann J, Szibor R (2005) Validation of the X-linked STR DXS6801. Forensic Sc...

Population data

The values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.
IDPopulationReferencePICHETMEC KrügerMEC KishidaMEC DesmaraisMEC Desmarais duoPD femalePD male
1Germany (areas Leipzig and Magdeburg)Edelman...0.58210.62690.39320.58210.58210.43400.81600.6269
2Germany (areas Leipzig and Magdeburg)Edelman...0.61210.65970.42130.61210.61210.46580.83660.6597
3Germany (areas Leipzig and Magdeburg)Edelman...0.59920.64560.40910.59920.59920.45200.82800.6456
ID Population Ethnic specification Reference n* 7 8 10 11 12 13 14 15
1 Germany (areas Leipzig and Magdeburg) Caucasian (European) Edelman... 340 females 0.0132 0.0471 0.5500 0.2279 0.1221 0.0368 0.0029
2 Germany (areas Leipzig and Magdeburg) Caucasian (European) Edelman... 806 males 0.0037 0.0161 0.0633 0.5012 0.2655 0.1154 0.0323 0.0025
3 Germany (areas Leipzig and Magdeburg) Caucasian (European) Edelman... 1146 0.0020 0.0148 0.0559 0.5236 0.2483 0.1184 0.0343 0.0027
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.

References

Note

No data.

News

Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.