ChrX-STR.org 2.0
This database covers many issues concerning the usage of X-chromosomal markers for forensic purpose



Marker DXS8377

Create date: Jun 25, 2009 12:18:15 PM
Last update: Jul 4, 2012 11:16:46 AM
Linkage group: X4
Cytogenetic localisation: q 28.00
Physical localisation NCBI 36: 149.310
Rutgers Map v.2: 183.66
Reference: Edelmann J, Hering, S, Michael, M, Lessig, R, Deichsel, D, Meier-Sundhausen, G,...

Primer

PrimerF: 5' - CACTTCATGGCTTACCACAG - 3'
PrimerR: 5' - GACCTTTGGAAAGCTAGTGT - 3'

Typical structure

AllelebpsSequence composition
38207PF-N31-(AGA)19-(GGA-AGA)5-(AGA)2-GGA-(AGA)6-N22-PR
41216PF-N31-(AGA)22-(GGA-AGA)5-(AGA)2-GGA-(AGA)6-N22-PR
42219PF-N31-(AGA)21-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22-PR, PF-N31-(AGA)23-(GGA-AGA)5-(AGA)2-GGA-(AGA)6-N22-PR
43222PF-N31-(AGA)22-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22-PR
44225PF-N31-(AGA)25-(GGA-AGA)5-(AGA)2-GGA-(AGA)6-N22-PR
45228PF-N31-(AGA)24-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22-PR
45282PF-N31-(AGA)26-(GGA-AGA)5-(AGA)2-GGA-(AGA)6-N22-PR
46231PF-N31-(AGA)25-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22-PR
47234PF-N31-(AGA)26-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22-PR, PF-N31-(AGA)28-(GGA-AGA)5-(AGA)2-GGA-(AGA)6-N22-PR
48237PF-N31-(AGA)27-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22-PR, PF-N31-(AGA)25-(GGA-AGA)7-(AGA)2-GGA-(AGA)6-N22-PR
49240PF-N31-(AGA)28-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22-PR, PF-N31-(AGA)30-(GGA-AGA)5-(AGA)2-GGA-(AGA)6-N22-PR
50243PF-N31-(AGA)29-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22- PR
51246PF-N31-(AGA)28-(GGA-AGA)7-(AGA)2-GGA-(AGA)6-N22-PR, PF-N31-(AGA)30-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22-PR, PF-N31-(AGA)32-(GGA-AGA)5-(AGA)2-GGA-(AGA)6-N22-PR
52249PF-N31-(AGA)31-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22-PR
53252PF-N31-(AGA)32-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22-PR
Comment: PF: sequence of primer PF (20 bp), PR: complementary sequence of primer PR (20 bp), N31: AGAGAGGAGAAGAAGGAGAAGGAGGAGAAGG, N22: CNGGGAACGAAGGAGCAAAAAT (differences to GDB sequence are underlined),
References: Edelmann J, Deichsel D, Hering S, Plate I, Szibor R (2002) Sequence variation a...

Cell line DNAAllele
K562 (BRL)52
K562 (Promega)52
NA365755
NA9947A45, 47
NA994849
References: Szibor R, Edelmann J, Hering S, Plate I, Wittig H, Roewer L, Wiegand P, Cali F,...

Population data

The values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.
IDPopulationReferencePICHETMEC KrügerMEC KishidaMEC DesmaraisMEC Desmarais duoPD femalePD male
1AustriaWiegand...0.91690.92230.84640.92120.91690.85150.98860.9223
2FinlandVauhkon...0.91070.91680.83100.91070.91070.84150.98700.9168
3GermanyEdelman...0.91610.92150.84100.91610.91610.85030.98840.9215
4GermanyFracass...0.91570.92120.84120.91680.91570.84970.98830.9212
5GermanyTabbada...0.90850.91470.82790.90880.90850.83820.98650.9147
6Germany (North East)Poetsch...0.90810.91450.82670.90810.90810.83760.98630.9145
7Germany (South)Wiegand...0.89710.90450.80750.89600.89710.82080.98340.9045
8Italy (Tuscany)Toni C,...0.90640.91300.82450.90740.90640.83470.98580.9130
9LatviaPoetsch...0.89750.90500.80880.89770.89750.82120.98340.9050
10Portugal (North)Pereira...0.91230.91810.83440.91220.91230.84440.98750.9181
11Spain (Basque country)Zarrabe...0.90670.91310.82360.90560.90670.83550.98600.9131
12Spain (Cantabria)Zarrabe...0.91960.92460.84710.91960.91960.85590.98930.9246
13Spain (Valencia)Aler M,...0.91820.92340.84440.91800.91820.85360.98890.9234
14TaiwanChen MY...0.89760.90530.80790.89760.89760.82090.98330.9053
ID Population Ethnic specification Reference n* 33 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
1 Austria Caucasian (European) Wiegand... 270 females 0.0080 0.0230 0.0340 0.0410 0.0490 0.0530 0.0830 0.0800 0.1050 0.1200 0.1020 0.0860 0.0800 0.0610 0.0410 0.0260 0.0040 0.0040 0.0040
2 Finland Caucasian Vauhkon... 103 0.0070 0.0070 0.0270 0.0270 0.0680 0.0680 0.0540 0.1160 0.1160 0.1090 0.1090 0.0950 0.0680 0.0610 0.0340 0.0130 0.0070 0.0070 0.0070
3 Germany Caucasian (European) Edelman... 557 0.0070 0.0100 0.0240 0.0310 0.0440 0.0430 0.0500 0.0690 0.0920 0.1100 0.1130 0.1270 0.0820 0.0630 0.0600 0.0400 0.0140 0.0140 0.0050 0.0010 0.0010
4 Germany Area of Münster Fracass... 217 both 0.0070 0.0170 0.0310 0.0140 0.0480 0.0510 0.0680 0.0750 0.0880 0.1020 0.0750 0.1160 0.1160 0.0920 0.0440 0.0270 0.0100 0.0100 0.0100
5 Germany Caucasian (European) Tabbada... 105 0.0313 0.0125 0.0250 0.0500 0.0500 0.0438 0.1000 0.0875 0.1063 0.1500 0.1063 0.0875 0.0563 0.0375 0.0125 0.0375 0.0063
6 Germany (North East) Caucasian (European) Poetsch... 205 0.0070 0.0160 0.0200 0.0430 0.0750 0.0490 0.0890 0.0950 0.0980 0.1050 0.1080 0.1380 0.0620 0.0430 0.0160 0.0200 0.0160
7 Germany (South) Caucasian (European) Wiegand... 220 females 0.0050 0.0140 0.0180 0.0180 0.0640 0.0450 0.0360 0.0320 0.0950 0.1180 0.1820 0.1140 0.0950 0.0730 0.0450 0.0180 0.0180 0.0090
8 Italy (Tuscany) Caucasian Toni C,... 160 0.0040 0.0040 0.0040 0.0170 0.0420 0.0710 0.0710 0.0670 0.0880 0.1250 0.1330 0.1080 0.0960 0.0750 0.0460 0.0170 0.0170 0.0080 0.0040 0.0040
9 Latvia Caucasian (European) Poetsch... 152 0.0068 0.0068 0.0270 0.0473 0.0203 0.0676 0.0743 0.0676 0.1689 0.1284 0.1149 0.1014 0.0608 0.0608 0.0135 0.0270 0.0068
10 Portugal (North) all Pereira... 347 males 0.0029 0.0115 0.0115 0.0202 0.0403 0.0288 0.0576 0.0432 0.0749 0.0980 0.1009 0.1239 0.1210 0.1153 0.0317 0.0519 0.0231 0.0144 0.0173 0.0115
11 Spain (Basque country) Caucasian (European) Zarrabe... 147 0.0080 0.0040 0.0080 0.0330 0.0330 0.0330 0.0420 0.0710 0.1130 0.1040 0.1040 0.0830 0.1540 0.0920 0.0330 0.0210 0.0380 0.0130 0.0080 0.0040
12 Spain (Cantabria) Caucasian (European) Zarrabe... 244 0.0120 0.0140 0.0200 0.0260 0.0630 0.0490 0.0630 0.0950 0.0690 0.1040 0.1100 0.0810 0.1120 0.0520 0.0580 0.0320 0.0200 0.0170 0.0030
13 Spain (Valencia) all Aler M,... 145 females 0.0034 0.0207 0.0172 0.0414 0.0448 0.0552 0.0828 0.1069 0.0724 0.0862 0.1000 0.1207 0.0862 0.0448 0.0517 0.0310 0.0172 0.0138 0.0034
14 Taiwan all Chen MY... 450 0.0030 0.0020 0.0030 0.0090 0.0190 0.0310 0.0820 0.0700 0.1350 0.1230 0.1260 0.1200 0.0890 0.0630 0.0650 0.0410 0.0120 0.0070
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.

References

Note

No data.

News

Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.