ChrX-STR.org 2.0
This database covers many issues concerning the usage of X-chromosomal markers for forensic purpose



Marker HPRTB

Create date: Jun 25, 2009 12:18:14 PM
Last update: Jul 13, 2011 9:42:29 AM
Linkage group: X3
Cytogenetic localisation: q 26.20
Physical localisation NCBI 36: 133.443
Rutgers Map v.2: 149.66
Reference: Hearne CM, Todd JA (1991) Tetranucleotide repeat polymorphism at the HPRT locus...

Primer

PrimerF: 5' - TCTCTATTTCCATCTCTGTCTCC - 3'
PrimerR: 5' - TCACCCCTGTCTATGGTCTCG - 3'

Typical structure

AllelebpsSequence composition
9-17144-176PF N30 (TCTA)n N34  PR
Comment: Typical Sequence composition,  N= Nucleotid, Allele variants are known
References: Mertens G, Gielis M, Mommers N, Mularoni A, Lamartine J, Heylen H, Muylle L, Va...

Cell line DNAAllele
K562 (BRL)13
K562 (Promega)13
NA365713
NA9947A14, 14
NA994814
References: Szibor R, Edelmann J, Hering S, Plate I, Wittig H, Roewer L, Wiegand P, Cali F,...

Population data

The values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.
IDPopulationReferencePICHETMEC KrügerMEC KishidaMEC DesmaraisMEC Desmarais duoPD femalePD male
1Argentina (Buenos Aires)Sala, A...0.72830.76540.54580.72590.72830.59380.90780.7654
2Brazil (Pernambuco)Maurici...0.72330.76120.54340.72450.72330.58810.90510.7612
3China (Guangdong)Genetic...0.68140.72340.49220.68140.68140.53970.88150.7234
4ChineseTabbada...0.65720.70840.46010.65720.65720.51380.86370.7084
5GermanyBecker ...0.69740.73890.51230.69700.69740.55900.89040.7389
6GermanyBecker ...0.68810.73220.49890.68760.68810.54810.88420.7322
7GermanyBecker ...0.69440.73670.50800.69400.69440.55550.88840.7367
8GermanyEdelman...0.73720.77170.56200.73720.73720.60470.91340.7717
9Germany (Baden-Württenberg)Szibor ...0.73260.76800.55120.72790.73260.59920.91070.7680
10Germany (North East)Poetsch...0.70080.74190.51580.70080.70080.56250.89230.7419
11GhanaBecker ...0.76540.79460.59990.76530.76540.63870.92860.7946
12HungaryFüredi,...0.71780.75510.53810.71780.71780.58210.90270.7551
13HungaryZalán A...0.71170.75110.52820.71060.71170.57510.89870.7511
14Italy (Tuscany)Toni C,...0.69240.73400.50770.69240.69240.55340.88770.7340
15Japan (Fukuoka)Becker ...0.61350.66740.40810.60080.61350.46850.83540.6674
16JapaneseTabbada...0.61370.66010.42210.61380.61370.46680.83810.6601
17KoreaShin KJ...0.63560.69050.43640.63680.63560.49060.84930.6905
18KoreaShin SH...0.63530.68070.44390.63530.63530.48970.85260.6807
19LatviaPoetsch...0.69490.73750.50730.69490.69490.55560.88850.7375
20Mexico (Jalisco)Rangel-...0.73450.77060.55630.73460.73450.60110.91120.7706
21PhilippineTabbada...0.62630.66920.43560.62640.62630.47930.84770.6692
22PolandPepinsk...0.69800.73920.51320.69800.69800.55950.89080.7392
23Spain (Basque country)Zarrabe...0.69040.73470.50020.69040.69040.55030.88530.7347
24Spain (Cantabria)Zarrabe...0.70620.74720.51850.70380.70620.56840.89510.7472
25Spain (Cantabria)Zarrabe...0.71570.75600.52980.71570.71570.57870.90010.7560
26Spain (Valencia)Aler M,...0.68030.72540.48920.68020.68030.53910.87950.7254
27TaiwanChen MY...0.65980.70950.46350.65980.65980.51640.86590.7095
28ThaiTabbada...0.70640.74780.52000.70660.70640.56840.89500.7478
29United KingdomPai, A....0.72060.75850.54020.72170.72060.58490.90370.7585
30USA (Afro-Americans)Edwards...0.73200.76880.55310.73200.73200.59840.90970.7688
31USA (Caucasian)Edwards...0.71120.75090.52740.71120.71120.57410.89820.7509
32USA (Hispanics)Edwards...0.67750.72460.48370.67750.67750.53580.87700.7246
ID Population Ethnic specification Reference n* 6 7 8 9 10 11 11.2 12 12.2 13 14 15 16 17 18 19
1 Argentina (Buenos Aires) Caucasoids Sala, A... 278 0.0320 0.1790 0.3160 0.2840 0.1370 0.0470 0.0030
2 Brazil (Pernambuco) all Maurici... 254 0.0160 0.0200 0.1460 0.2950 0.3190 0.1650 0.0240 0.0160
3 China (Guangdong) Asian (Chinese Han) Genetic... 272 both 0.1000 0.2225 0.4175 0.2000 0.0525 0.0075
4 Chinese Asian Tabbada... 90 0.0700 0.3300 0.3800 0.1800 0.0300 0.0100
5 Germany Caucasian (European) Becker ... 278 females 0.0054 0.0072 0.1299 0.0054 0.3537 0.3212 0.1155 0.0487 0.0126
6 Germany Caucasian (European) Becker ... 439 males 0.0091 0.0023 0.1366 0.0045 0.3530 0.3280 0.1252 0.0341 0.0068
7 Germany Caucasian (European) Becker ... 717 0.0066 0.0055 0.1322 0.0051 0.3535 0.3235 0.1187 0.0438 0.0107
8 Germany Caucasian (European) Edelman... 335 0.0100 0.0190 0.1160 0.2760 0.3220 0.1690 0.0760 0.0120
9 Germany (Baden-Württenberg) Caucasian (European) Szibor ... 643 0.0050 0.0140 0.1310 0.2870 0.3220 0.1520 0.0730 0.0120
10 Germany (North East) Caucasian (European) Poetsch... 205 0.0030 0.0070 0.1180 0.3410 0.3280 0.1110 0.0890 0.0030
11 Ghana all Becker ... 59 males 0.0508 0.1017 0.3051 0.2373 0.1695 0.1186 0.0169
12 Hungary all Füredi,... 242 0.0050 0.0200 0.0100 0.1320 0.3530 0.2840 0.1370 0.0540 0.0050
13 Hungary all Zalán A... 384 0.0040 0.0220 0.0050 0.1130 0.0020 0.3220 0.3240 0.1580 0.0440 0.0050
14 Italy (Tuscany) Caucasian Toni C,... 160 0.0080 0.0170 0.1170 0.0040 0.3750 0.3080 0.1210 0.0420 0.0080
15 Japan (Fukuoka) Asian (Japanese) Becker ... 93 males 0.0645 0.3226 0.4624 0.0968 0.0323 0.0108
16 Japanese Asian Tabbada... 95 males 0.0316 0.2421 0.5053 0.1474 0.0526 0.0211
17 Korea Asian (Korean) Shin KJ... 300 0.0360 0.3130 0.4160 0.1890 0.0360 0.0110
18 Korea Asian (Korean) Shin SH... 401 0.0040 0.0510 0.2490 0.4780 0.1490 0.0630 0.0060
19 Latvia Caucasian (European) Poetsch... 152 0.0068 0.0135 0.1486 0.3649 0.2973 0.1351 0.0135 0.0068 0.0135
20 Mexico (Jalisco) all Rangel-... 173 0.0043 0.0043 0.0086 0.0730 0.2790 0.3047 0.2017 0.1116 0.0129
21 Philippine Asian Tabbada... 115 0.0983 0.2139 0.5029 0.1445 0.0405
22 Poland all Pepinsk... 240 0.0222 0.1111 0.3639 0.3056 0.1417 0.0444 0.0083 0.0028
23 Spain (Basque country) Caucasian (European) Zarrabe... 147 0.0050 0.0140 0.1450 0.3180 0.3500 0.1400 0.0280
24 Spain (Cantabria) Caucasian (European) Zarrabe... 244 0.0080 0.0080 0.1460 0.3360 0.3110 0.1430 0.0360 0.0060 0.0020 0.0020
25 Spain (Cantabria) Caucasian (European) Zarrabe... 131 0.0150 0.0050 0.1720 0.3180 0.2930 0.1620 0.0300 0.0050
26 Spain (Valencia) all Aler M,... 145 females 0.1172 0.0103 0.3828 0.3000 0.1517 0.0345 0.0034
27 Taiwan all Chen MY... 571 0.0736 0.2995 0.3993 0.1856 0.0385 0.0035
28 Thai Asian Tabbada... 157 0.1263 0.2980 0.0051 0.3384 0.1768 0.0354 0.0202
29 United Kingdom all Pai, A.... 364 0.0030 0.0230 0.1600 0.3380 0.2820 0.1370 0.0530 0.0050
30 USA (Afro-Americans) all Edwards... 178 0.0040 0.0180 0.0150 0.0690 0.2570 0.3040 0.2460 0.0830 0.0040
31 USA (Caucasian) Caucasian Edwards... 168 0.0020 0.0050 0.0100 0.1340 0.3430 0.2950 0.1560 0.0430 0.0120
32 USA (Hispanics) all Edwards... 169 0.0050 0.0620 0.3000 0.3710 0.2000 0.0620
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.

References

Note

No data.

News

Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.