ChrX-STR.org 2.0
Database and information hub for forensic X-chromosomal markers

Marker DXS10134

Create date:	Jun 25, 2009 12:18:15 PM
Last update:	Jul 13, 2011 9:35:35 AM

Linkage group:	X4
Cytogenetic localisation:	q 28.00
Physical localisation NCBI 36:	149.401
Rutgers Map v.2:	183.96

Reference:	Edelmann J, Hering S, Augustin C, Szibor R (2008) Characterisation of the STR m...

Primer

PrimerF:

5' -

CCTGGGTGACATAGAGAGAC

- 3'

PrimerR:

5' -

TGGTTGAGCCCCTGCTTTC

- 3'

Typical structure

Allele	bps	Sequence composition
32	240	[(GAAA)4-AAA]1 (GAAA)12
33	244	[(GAAA)4-AAA]1 (GAAA)13
34	248	[(GAAA)4-AAA]1 (GAAA)14
35	252	[(GAAA)4-AAA]1 (GAAA)15
36	256	[(GAAA)4-AAA]1 (GAAA)16
37	260	[(GAAA)4-AAA]1 (GAAA)17
37.2	262	[(GAAA)4-AAA]1 (GAAA)17 + 2 bp
38	264	[(GAAA)4-AAA]1 (GAAA)18
39	268	[(GAAA)4-AAA]1 (GAAA)19
39.3	271	[(GAAA)4-AAA]2 (GAAA)15
40.3	275	[(GAAA)4-AAA]2 (GAAA)16
41.3	279	[(GAAA)4-AAA]2 (GAAA)17
42.3	283	[(GAAA)4-AAA]2 (GAAA)18
43.2	287	[(GAAA)4-AAA]2 (GAAA)19
44.3	291	[(GAAA)4-AAA]2 (GAAA)20

References:

Edelmann J, Hering S, Augustin C, Szibor R (2008) Characterisation of the STR m...

Cell line DNA	Allele
9947A (Promega)	35, 36
K562 (Promega)	32

References:

Edelmann J, Hering S, Augustin C, Szibor R (2008) Characterisation of the STR m...

Population data

The values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.

ID	Population	Reference	PIC	HET	MEC Krüger	MEC Kishida	MEC Desmarais	MEC Desmarais duo	PD female	PD male
1	China (Guangdong)	Genetic...	0.8497	0.8637	0.7300	0.8497	0.8497	0.7512	0.9674	0.8637
2	Germany	Becker ...	0.8362	0.8522	0.7083	0.8354	0.8362	0.7325	0.9621	0.8522
3	Germany	Becker ...	0.8495	0.8636	0.7285	0.8481	0.8495	0.7510	0.9673	0.8636
4	Germany	Becker ...	0.8398	0.8553	0.7129	0.8380	0.8398	0.7374	0.9635	0.8553
5	Germany	Edelman...	0.8395	0.8552	0.7156	0.8411	0.8395	0.7371	0.9634	0.8552
6	Ghana	Becker ...	0.8490	0.8636	0.7273	0.8489	0.8490	0.7497	0.9668	0.8636
7	Japan (Fukuoka)	Becker ...	0.7922	0.8149	0.6442	0.7924	0.7922	0.6742	0.9431	0.8149

ID	Population	Ethnic specification	Reference	n*	29	30	31	31.1	32	33	34	34.2	35	35.3	36	36.3	37	37.2	37.3	38	38.3	39	39.3	40	40.3	41	41.3	42.3	43.3	44.3
1	China (Guangdong)	Asian (Chinese Han)	Genetic...	272 both		0.0025	0.0100		0.0550	0.0450	0.0875		0.1375	0.0050	0.1850	0.0025	0.2275		0.0200	0.1250	0.0175	0.0425	0.0025	0.0175	0.0050	0.0050	0.0050	0.0025
2	Germany	Caucasian (European)	Becker ...	278 females	0.0018		0.0036		0.0162	0.0415	0.1155		0.1985		0.2436	0.0018	0.1462		0.0036	0.0974	0.0216	0.0180	0.0288	0.0036	0.0270		0.0198	0.0072	0.0018	0.0018
3	Germany	Caucasian (European)	Becker ...	439 males					0.0089	0.0507	0.1343		0.2238		0.1850	0.0029	0.1462		0.0029	0.0746	0.0208	0.0238	0.0268	0.0029	0.0388	0.0029	0.0208	0.0268	0.0029	0.0029
4	Germany	Caucasian (European)	Becker ...	717	0.0012		0.0024		0.0138	0.0436	0.1210		0.1991		0.2361	0.0019	0.1460		0.0039	0.0907	0.0205	0.0211	0.0276	0.0039	0.0279	0.0007	0.0208	0.0124	0.0019	0.0019
5	Germany	Caucasian (European)	Edelman...	655		0.0012	0.0024		0.0082	0.0541	0.1069		0.2092		0.2221		0.1680	0.0024		0.0588		0.0353	0.0364		0.0435		0.0270	0.0188	0.0059	0.0012
6	Ghana	all	Becker ...	59 males		0.0877	0.0175	0.0175	0.0175	0.0702	0.0702	0.0175	0.1053		0.1754		0.1930			0.1930		0.0351
7	Japan (Fukuoka)	Asian (Japanese)	Becker ...	93 males					0.0323	0.0215	0.0323		0.1613		0.2258		0.3011		0.0215	0.1075	0.0108	0.0430	0.0215	0.0215

n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.

References

No reference data.

Note

No data.

Manage

Manage access

News

Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.

Data Protection | Imprint |