|
Marker DXS8378
| Create date: |
Jun 25, 2009 12:18:12 PM |
| Last update: |
Jul 4, 2012 11:07:13 AM |
 |
|
| Linkage group: |
X1 |
| Cytogenetic localisation: |
p 22.31 |
| Physical localisation NCBI 36: |
9.330 |
| Rutgers Map v.2: |
20.21 |
|
|
| Reference: |
Edelmann J, Hering, S, Michael, M, Lessig, R, Deichsel, D, Meier-Sundhausen, G,... |
Primer
| PrimerF: |
5' - |
TTAGGCAACCCGGTGGTCC |
- 3' |
| PrimerR: |
5' - |
ACAAGAACGAAACTCCAACTC |
- 3' |
Typical structure| 8-14 | 110-134 | PF-N18-(CTAT)8–14-N20-PR |
| K562 (BRL) | 10 | | K562 (Promega) | 10 | | NA3657 | 12 | | NA9947A | 10, 11 | | NA9948 | 11 |
Population dataThe values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.| 1 | Belo Horizonte, Brazil | Genetic... | 0.6165 | 0.6829 | 0.4016 | 0.6165 | 0.6165 | 0.4696 | 0.8331 | 0.6829 | | 2 | China (Guangdong) | Genetic... | 0.5329 | 0.6026 | 0.3342 | 0.5329 | 0.5329 | 0.3877 | 0.7724 | 0.6026 | | 3 | Germany | Becker ... | 0.6511 | 0.7068 | 0.4471 | 0.6507 | 0.6511 | 0.5067 | 0.8583 | 0.7068 | | 4 | Germany | Becker ... | 0.6404 | 0.6998 | 0.4321 | 0.6399 | 0.6404 | 0.4951 | 0.8505 | 0.6998 | | 5 | Germany | Becker ... | 0.6479 | 0.7047 | 0.4425 | 0.6475 | 0.6479 | 0.5032 | 0.8559 | 0.7047 | | 6 | Germany | Edelman... | 0.6577 | 0.7127 | 0.4541 | 0.6577 | 0.6577 | 0.5138 | 0.8625 | 0.7127 | | 7 | Germany | Fracass... | 0.6338 | 0.6948 | 0.4247 | 0.6338 | 0.6338 | 0.4881 | 0.8459 | 0.6948 | | 8 | Germany (North East) | Poetsch... | 0.6434 | 0.7004 | 0.4398 | 0.6446 | 0.6434 | 0.4985 | 0.8532 | 0.7004 | | 9 | Ghana | Becker ... | 0.6330 | 0.6947 | 0.4218 | 0.6329 | 0.6330 | 0.4869 | 0.8451 | 0.6947 | | 10 | Japan (Fukuoka) | Becker ... | 0.5595 | 0.6142 | 0.3617 | 0.5596 | 0.5595 | 0.4109 | 0.7964 | 0.6142 | | 11 | Latvia | Poetsch... | 0.6980 | 0.7413 | 0.5093 | 0.6981 | 0.6980 | 0.5590 | 0.8897 | 0.7413 | | 12 | Poland | Pepinsk... | 0.6361 | 0.6972 | 0.4260 | 0.6361 | 0.6361 | 0.4903 | 0.8472 | 0.6972 | | 13 | Portugal (North) | Pereira... | 0.6295 | 0.6914 | 0.4191 | 0.6295 | 0.6295 | 0.4834 | 0.8429 | 0.6914 | | 14 | Rio de Janeiro, Brazil | Genetic... | 0.6214 | 0.6838 | 0.4114 | 0.6214 | 0.6214 | 0.4749 | 0.8376 | 0.6838 | | 15 | Spain (Valencia) | Aler M,... | 0.6662 | 0.7188 | 0.4653 | 0.6661 | 0.6662 | 0.5232 | 0.8683 | 0.7188 | | 16 | São Paulo, Brazil | Genetic... | 0.6076 | 0.6735 | 0.3954 | 0.6076 | 0.6076 | 0.4606 | 0.8275 | 0.6735 | | 17 | Vitória, Brazil | Genetic... | 0.6201 | 0.6848 | 0.4067 | 0.6201 | 0.6201 | 0.4733 | 0.8359 | 0.6848 |
| 1 |
Belo Horizonte, Brazil |
admixed |
Genetic... |
245 |
|
|
0.0026 |
0.3514 |
0.3286 |
0.2919 |
0.0198 |
0.0057 |
|
|
| 2 |
China (Guangdong) |
Asian (Chinese Han) |
Genetic... |
272 both |
|
|
0.0225 |
0.5250 |
0.3325 |
0.1025 |
0.0150 |
0.0025 |
|
|
| 3 |
Germany |
Caucasian (European) |
Becker ... |
278 females |
|
|
0.0180 |
0.3483 |
0.3303 |
0.2454 |
0.0469 |
0.0072 |
|
0.0036 |
| 4 |
Germany |
Caucasian (European) |
Becker ... |
439 males |
|
0.0045 |
0.0205 |
0.3318 |
0.3386 |
0.2723 |
0.0297 |
|
0.0022 |
|
| 5 |
Germany |
Caucasian (European) |
Becker ... |
717 |
|
0.0015 |
0.0188 |
0.3428 |
0.3331 |
0.2544 |
0.0412 |
0.0048 |
0.0007 |
0.0024 |
| 6 |
Germany |
Caucasian (European) |
Edelman... |
427 |
|
0.0020 |
0.0460 |
0.3120 |
0.3320 |
0.2770 |
0.0290 |
0.0020 |
|
|
| 7 |
Germany |
Area of Münster |
Fracass... |
217 both |
|
|
0.0220 |
0.3440 |
0.3380 |
0.2680 |
0.0160 |
0.0090 |
0.0030 |
|
| 8 |
Germany (North East) |
Caucasian (European) |
Poetsch... |
205 |
|
0.0030 |
0.0260 |
0.3120 |
0.3740 |
0.2460 |
0.0330 |
0.0070 |
|
|
| 9 |
Ghana |
all |
Becker ... |
59 males |
|
|
|
0.3051 |
0.3559 |
0.2881 |
0.0508 |
|
|
|
| 10 |
Japan (Fukuoka) |
Asian (Japanese) |
Becker ... |
93 males |
|
|
0.0108 |
0.5484 |
0.1828 |
0.2258 |
0.0215 |
0.0108 |
|
|
| 11 |
Latvia |
Caucasian (European) |
Poetsch... |
152 |
|
0.0270 |
0.0541 |
0.3514 |
0.2432 |
0.2635 |
0.0541 |
0.0068 |
|
|
| 12 |
Poland |
all |
Pepinsk... |
240 |
|
0.0028 |
0.0111 |
0.3306 |
0.3250 |
0.2944 |
0.0333 |
|
0.0028 |
|
| 13 |
Portugal (North) |
all |
Pereira... |
347 males |
|
|
0.0144 |
0.2795 |
0.3055 |
0.3689 |
0.0288 |
0.0029 |
|
|
| 14 |
Rio de Janeiro, Brazil |
admixed |
Genetic... |
261 |
|
|
0.0098 |
0.3128 |
0.3941 |
0.2488 |
0.0320 |
0.0025 |
|
|
| 15 |
Spain (Valencia) |
all |
Aler M,... |
145 females |
0.0034 |
|
0.0276 |
0.2862 |
0.3379 |
0.2862 |
0.0483 |
0.0103 |
|
|
| 16 |
São Paulo, Brazil |
admixed |
Genetic... |
250 |
|
|
0.0121 |
0.3986 |
0.3333 |
0.2367 |
0.0193 |
|
|
|
| 17 |
Vitória, Brazil |
admixed |
Genetic... |
245 |
|
|
0.0048 |
0.3062 |
0.3704 |
0.2889 |
0.0272 |
0.0025 |
|
|
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.
References
- Aler A, Sanchez-Diz P, Gomes I, Gisbert M, Carracedo A, Amorim A, Gusmao L (2007) Genetic data of 1...
- Asamura H, Sakai H, Kobayashi K, Ota M, Fukushima H (2006) MiniX-STR multiplex system population st...
- Caine LM, Pontes L, Abrantes D, Lima G, Pinheiro F (2007) Genetic data of 4 X-chromosomal short tan...
- Caine LM, Pontes L, Abrantes D, Lima G, Pinheiro F (2007) Genetic data of four X-chromosomal STRs i...
- Catanesi CI, Martina PF, Giovambattista G, Zukas P, Vidal-Rioja L (2007) Geographic structure in gr...
- Edelmann J, Deichsel D, Hering S, Plate I, Szibor R (2002) Sequence variation and allele nomenclatu...
- Edelmann J, Szibor R (2003) The X-linked STRs DXS7130 and DXS6803. Forensic Science International 1...
- Fracasso T, Schurenkamp M, Brinkmann B, Hohoff C (2008) An X-STR meiosis study in Kurds and Germans...
- Gomes I, Alves C, Maxzud K, Pereira R, Prata MJ, Sanchez-Diz P, Carracedo A, Amorim A, Gusmao L (20...
- Gomes I, Prinz M, Pereira R, Meyers C, Mikulasovich RS, Amorim A, Carracedo A, Gusmao L (2007) Gene...
- Gu SZ, Li SB (2006) X-chromosome STRs analysis of Ewenke ethnic population. Forensic Science Intern...
- Hundertmark T, Hering S, Edelmann J, Augustin C, Plate I, Szibor R (2008) The STR cluster DXS10148-...
- Kang LL, Li SB (2006) X-chromosome STR polymorphism of Luoba Ethnic Group living in Tibet (SW China...
- Liu QB, Li SB (2006) Patterns of genetic polymorphism at the 10 X-chromosome STR loci in Mongol pop...
- Pereira R, Gomes I, Amorim A, Gusmao L (2007) Genetic diversity of 10 X chromosome STRs in northern...
- Pico A, Castillo A, Vargas C, Amorim A, Gusmao L (2008) Genetic profile characterization and segreg...
- Poetsch M, El-Mostaqim D, Tschentscher F, Browne E, Timmann C, Horstmann R, von Wurmb-Schwark N (20...
- Poetsch M, Petersmann H, Repenning A, Lignitz E (2005) Development of two pentaplex systems with X-...
- Poetsch M, Sabule A, Petersmann H, Volksone V, Lignitz E (2006) Population data of 10 X-chromosomal...
- Robino C, Giolitti A, Gino S, Torre C (2006) Development of two multiplex PCR systems for the analy...
- Shin SH, Yu JS, Park SW, Min GS, Chung KW (2005) Genetic analysis of 18 X-linked short tandem repea...
- Son JY, Lee YS, Choung CM, Lee SD (2002) Polymorphism of nine X chromosomal STR loci in Koreans. In...
- Szibor R (2007) X-chromosomal markers: past, present and future. Forensic Sci Int Genet 1:93-99
- Szibor R, Edelmann J, Hering S, Plate I, Wittig H, Roewer L, Wiegand P, Cali F, Romano V, Michael M...
- Szibor R, Krawczak M, Hering S, Edelmann J, Kuhlisch E, Krause D (2003) Use of X-linked markers for...
- Tang WM, To KY (2006) Four X-chromosomal STRs and their allele frequencies in a Chinese population....
- Tariq MA, Ullah O, Riazuddin SA, Riazuddin S (2008) Allele frequency distribution of 13 X-chromosom...
- Turrina S, Atzei R, De Leo D (2007) Polymorphism of four X-chromosomal STRs: DXS7423, DXS7424, DXS8...
- Turrina S, Atzei R, Filippini G, De Leo D (2007) Development and forensic validation of a new multi...
- Yu B, Zhang HB, Li SB (2005) X-chromosome STRs polymorphisms of Han ethnic group from Northwest Chi...
- Zalan A, Volgyi A, Brabetz W, Schleinitz D, Pamjav H (2008) Hungarian population data of eight X-li...
- Zalan A, Volgyi A, Jung M, Peterman O, Pamjav H (2007) Hungarian population data of four X-linked m...
NoteNo data.
|
 |
News
Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.
|
|
