ChrX-STR.org 2.0
This database covers many issues concerning the usage of X-chromosomal markers for forensic purpose



Marker DXS8378

Create date: Jun 25, 2009 12:18:12 PM
Last update: Jul 4, 2012 11:07:13 AM
Linkage group: X1
Cytogenetic localisation: p 22.31
Physical localisation NCBI 36: 9.330
Rutgers Map v.2: 20.21
Reference: Edelmann J, Hering, S, Michael, M, Lessig, R, Deichsel, D, Meier-Sundhausen, G,...

Primer

PrimerF: 5' - TTAGGCAACCCGGTGGTCC - 3'
PrimerR: 5' - ACAAGAACGAAACTCCAACTC - 3'

Typical structure

AllelebpsSequence composition
8-14110-134PF-N18-(CTAT)8–14-N20-PR
Comment: N= Nucleotide
References: Edelmann J, Deichsel D, Hering S, Plate I, Szibor R (2002) Sequence variation a...

Cell line DNAAllele
K562 (BRL)10
K562 (Promega)10
NA365712
NA9947A10, 11
NA994811
References: Szibor R, Edelmann J, Hering S, Plate I, Wittig H, Roewer L, Wiegand P, Cali F,...

Population data

The values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.
IDPopulationReferencePICHETMEC KrügerMEC KishidaMEC DesmaraisMEC Desmarais duoPD femalePD male
1Belo Horizonte, BrazilGenetic...0.61650.68290.40160.61650.61650.46960.83310.6829
2China (Guangdong)Genetic...0.53290.60260.33420.53290.53290.38770.77240.6026
3GermanyBecker ...0.65110.70680.44710.65070.65110.50670.85830.7068
4GermanyBecker ...0.64040.69980.43210.63990.64040.49510.85050.6998
5GermanyBecker ...0.64790.70470.44250.64750.64790.50320.85590.7047
6GermanyEdelman...0.65770.71270.45410.65770.65770.51380.86250.7127
7GermanyFracass...0.63380.69480.42470.63380.63380.48810.84590.6948
8Germany (North East)Poetsch...0.64340.70040.43980.64460.64340.49850.85320.7004
9GhanaBecker ...0.63300.69470.42180.63290.63300.48690.84510.6947
10Japan (Fukuoka)Becker ...0.55950.61420.36170.55960.55950.41090.79640.6142
11LatviaPoetsch...0.69800.74130.50930.69810.69800.55900.88970.7413
12PolandPepinsk...0.63610.69720.42600.63610.63610.49030.84720.6972
13Portugal (North)Pereira...0.62950.69140.41910.62950.62950.48340.84290.6914
14Rio de Janeiro, BrazilGenetic...0.62140.68380.41140.62140.62140.47490.83760.6838
15Spain (Valencia)Aler M,...0.66620.71880.46530.66610.66620.52320.86830.7188
16São Paulo, BrazilGenetic...0.60760.67350.39540.60760.60760.46060.82750.6735
17Vitória, BrazilGenetic...0.62010.68480.40670.62010.62010.47330.83590.6848
ID Population Ethnic specification Reference n* 7 8 9 10 11 12 13 14 15 17
1 Belo Horizonte, Brazil admixed Genetic... 245 0.0026 0.3514 0.3286 0.2919 0.0198 0.0057
2 China (Guangdong) Asian (Chinese Han) Genetic... 272 both 0.0225 0.5250 0.3325 0.1025 0.0150 0.0025
3 Germany Caucasian (European) Becker ... 278 females 0.0180 0.3483 0.3303 0.2454 0.0469 0.0072 0.0036
4 Germany Caucasian (European) Becker ... 439 males 0.0045 0.0205 0.3318 0.3386 0.2723 0.0297 0.0022
5 Germany Caucasian (European) Becker ... 717 0.0015 0.0188 0.3428 0.3331 0.2544 0.0412 0.0048 0.0007 0.0024
6 Germany Caucasian (European) Edelman... 427 0.0020 0.0460 0.3120 0.3320 0.2770 0.0290 0.0020
7 Germany Area of Münster Fracass... 217 both 0.0220 0.3440 0.3380 0.2680 0.0160 0.0090 0.0030
8 Germany (North East) Caucasian (European) Poetsch... 205 0.0030 0.0260 0.3120 0.3740 0.2460 0.0330 0.0070
9 Ghana all Becker ... 59 males 0.3051 0.3559 0.2881 0.0508
10 Japan (Fukuoka) Asian (Japanese) Becker ... 93 males 0.0108 0.5484 0.1828 0.2258 0.0215 0.0108
11 Latvia Caucasian (European) Poetsch... 152 0.0270 0.0541 0.3514 0.2432 0.2635 0.0541 0.0068
12 Poland all Pepinsk... 240 0.0028 0.0111 0.3306 0.3250 0.2944 0.0333 0.0028
13 Portugal (North) all Pereira... 347 males 0.0144 0.2795 0.3055 0.3689 0.0288 0.0029
14 Rio de Janeiro, Brazil admixed Genetic... 261 0.0098 0.3128 0.3941 0.2488 0.0320 0.0025
15 Spain (Valencia) all Aler M,... 145 females 0.0034 0.0276 0.2862 0.3379 0.2862 0.0483 0.0103
16 São Paulo, Brazil admixed Genetic... 250 0.0121 0.3986 0.3333 0.2367 0.0193
17 Vitória, Brazil admixed Genetic... 245 0.0048 0.3062 0.3704 0.2889 0.0272 0.0025
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.

References

Note

No data.

News

Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.