ChrX-STR.org 2.0
Database and information hub for forensic X-chromosomal markers

Marker DXS7132

Create date:	Jun 25, 2009 12:18:12 PM
Last update:	Jul 13, 2011 9:41:22 AM

Linkage group:	X2
Cytogenetic localisation:	c
Physical localisation NCBI 36:	64.572
Genetic localisation deCODE:	80.01
Rutgers Map v.2:	90.75

Reference:	Edelmann J, Hering, S, Michael, M, Lessig, R, Deichsel, D, Meier-Sundhausen, G,...

Primer

PrimerF:

5' -

GAGCCCATTTTAATAAATCC

- 3'

PrimerR:

5' -

GCCAAACTCTATTAGTCAAC

- 3'

Typical structure

Allele	bps	Sequence composition
11-17	131–155	PF N19 (TCTA)11-17 N28 PR

Comment:

N= Nucleotide

References:

Edelmann J, Deichsel D, Hering S, Plate I, Szibor R (2002) Sequence variation a...

Cell line DNA	Allele
K562 (BRL)	13
K562 (Promega)	13
NA3657	12
NA9947A	12, 12
NA9948	13

References:

Szibor R, Edelmann J, Hering S, Plate I, Wittig H, Roewer L, Wiegand P, Cali F,...

Population data

The values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.

ID	Population	Reference	PIC	HET	MEC Krüger	MEC Kishida	MEC Desmarais	MEC Desmarais duo	PD female	PD male
1	Belo Horizonte, Brazil	Genetic...	0.6983	0.7389	0.5126	0.6983	0.6983	0.5593	0.8912	0.7389
2	China (Guangdong)	Genetic...	0.6990	0.7390	0.5135	0.6990	0.6990	0.5599	0.8919	0.7390
3	Germany	Becker ...	0.6936	0.7372	0.5041	0.6935	0.6936	0.5539	0.8873	0.7372
4	Germany	Becker ...	0.7023	0.7454	0.5131	0.7020	0.7023	0.5637	0.8920	0.7454
5	Germany	Becker ...	0.6972	0.7406	0.5077	0.6968	0.6972	0.5580	0.8893	0.7406
6	Germany	Edelman...	0.6874	0.7317	0.4965	0.6874	0.6874	0.5468	0.8837	0.7317
7	Ghana	Becker ...	0.6986	0.7418	0.5093	0.6985	0.6986	0.5594	0.8901	0.7418
8	Hungary	Zalán A...	0.7070	0.7477	0.5204	0.7070	0.7070	0.5688	0.8956	0.7477
9	Japan (Fukuoka)	Becker ...	0.6460	0.6962	0.4546	0.6461	0.6460	0.5029	0.8575	0.6962
10	Korea	Shin SH...	0.7315	0.7679	0.5499	0.7291	0.7315	0.5975	0.9097	0.7679
11	Poland	Pepinsk...	0.6644	0.7146	0.4683	0.6645	0.6644	0.5217	0.8684	0.7146
12	Portugal (North)	Pereira...	0.6933	0.7375	0.5029	0.6934	0.6933	0.5534	0.8869	0.7375
13	Rio de Janeiro, Brazil	Genetic...	0.7072	0.7460	0.5244	0.7072	0.7072	0.5696	0.8966	0.7460
14	Spain (Valencia)	Aler M,...	0.7117	0.7525	0.5245	0.7115	0.7117	0.5740	0.8980	0.7525
15	São Paulo, Brazil	Genetic...	0.7246	0.7623	0.5437	0.7243	0.7246	0.5897	0.9057	0.7623
16	Taiwan	Chen MY...	0.7163	0.7550	0.5336	0.7163	0.7163	0.5799	0.9013	0.7550
17	Vitória, Brazil	Genetic...	0.7431	0.7772	0.5693	0.7431	0.7431	0.6119	0.9162	0.7772

ID	Population	Ethnic specification	Reference	n*	6	8	9	10	11	12	13	14	14.3	15	15.3	16	16.3	17	17.3	18	18.3	19
1	Belo Horizonte, Brazil	admixed	Genetic...	245					0.0169	0.0850	0.2406	0.3854		0.2125		0.0426	0.0058	0.0112
2	China (Guangdong)	Asian (Chinese Han)	Genetic...	272 both					0.0025	0.0875	0.1850	0.3900		0.2475		0.0750		0.0125
3	Germany	Caucasian (European)	Becker ...	278 females					0.0054	0.1011	0.2978	0.3574		0.1859		0.0379		0.0126		0.0018
4	Germany	Caucasian (European)	Becker ...	439 males					0.0045	0.0911	0.3075	0.3189		0.2186		0.0455		0.0114		0.0023
5	Germany	Caucasian (European)	Becker ...	717					0.0051	0.0977	0.3011	0.3445		0.1968		0.0404		0.0122		0.0019
6	Germany	Caucasian (European)	Edelman...	412					0.0120	0.0890	0.2660	0.3790		0.2110		0.0360		0.0070
7	Ghana	all	Becker ...	59 males					0.0175	0.1228	0.1754	0.3333		0.3158		0.0351
8	Hungary	all	Zalán A...	384	0.0020				0.0020	0.1220	0.2620	0.3590		0.1930		0.0510		0.0070				0.0020
9	Japan (Fukuoka)	Asian (Japanese)	Becker ...	93 males						0.0753	0.0968	0.4086		0.3441		0.0538		0.0215
10	Korea	Asian (Korean)	Shin SH...	401				0.0010	0.0080	0.1140	0.2360	0.3280		0.2250		0.0700		0.0150		0.0010
11	Poland	all	Pepinsk...	240					0.0111	0.0722	0.3306	0.3667		0.1889		0.0250		0.0056
12	Portugal (North)	all	Pereira...	347 males					0.0202	0.1009	0.2911	0.3545		0.2017		0.0288		0.0029
13	Rio de Janeiro, Brazil	admixed	Genetic...	261					0.0074	0.0887	0.2512	0.3768	0.0025	0.1946	0.0025	0.0517	0.0197		0.0049
14	Spain (Valencia)	all	Aler M,...	145 females			0.0034		0.0172	0.1414	0.2517	0.3448		0.2103		0.0276		0.0034
15	São Paulo, Brazil	admixed	Genetic...	250				0.0048	0.0194	0.1044	0.2233	0.3277		0.2597	0.0024	0.0388	0.0072	0.0097	0.0024
16	Taiwan	all	Chen MY...	414		0.0020			0.0040	0.0860	0.2080	0.3510		0.2550		0.0770		0.0130		0.0020		0.0020
17	Vitória, Brazil	admixed	Genetic...	245					0.0222	0.1012	0.2642	0.3012		0.2197		0.0519	0.0173	0.0173		0.0025	0.0025

n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.

References

Note

No data.

Manage

Manage access

News

Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.

Data Protection | Imprint |