|
Marker DXS8377
| Create date: |
Jun 25, 2009 12:18:15 PM |
| Last update: |
Jul 4, 2012 11:16:46 AM |
 |
|
| Linkage group: |
X4 |
| Cytogenetic localisation: |
q 28.00 |
| Physical localisation NCBI 36: |
149.310 |
| Rutgers Map v.2: |
183.66 |
|
|
| Reference: |
Edelmann J, Hering, S, Michael, M, Lessig, R, Deichsel, D, Meier-Sundhausen, G,... |
Primer
| PrimerF: |
5' - |
CACTTCATGGCTTACCACAG |
- 3' |
| PrimerR: |
5' - |
GACCTTTGGAAAGCTAGTGT |
- 3' |
Typical structure| 38 | 207 | PF-N31-(AGA)19-(GGA-AGA)5-(AGA)2-GGA-(AGA)6-N22-PR | | 41 | 216 | PF-N31-(AGA)22-(GGA-AGA)5-(AGA)2-GGA-(AGA)6-N22-PR | | 42 | 219 | PF-N31-(AGA)21-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22-PR, PF-N31-(AGA)23-(GGA-AGA)5-(AGA)2-GGA-(AGA)6-N22-PR | | 43 | 222 | PF-N31-(AGA)22-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22-PR | | 44 | 225 | PF-N31-(AGA)25-(GGA-AGA)5-(AGA)2-GGA-(AGA)6-N22-PR | | 45 | 228 | PF-N31-(AGA)24-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22-PR | | 45 | 282 | PF-N31-(AGA)26-(GGA-AGA)5-(AGA)2-GGA-(AGA)6-N22-PR | | 46 | 231 | PF-N31-(AGA)25-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22-PR | | 47 | 234 | PF-N31-(AGA)26-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22-PR, PF-N31-(AGA)28-(GGA-AGA)5-(AGA)2-GGA-(AGA)6-N22-PR | | 48 | 237 | PF-N31-(AGA)27-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22-PR, PF-N31-(AGA)25-(GGA-AGA)7-(AGA)2-GGA-(AGA)6-N22-PR | | 49 | 240 | PF-N31-(AGA)28-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22-PR, PF-N31-(AGA)30-(GGA-AGA)5-(AGA)2-GGA-(AGA)6-N22-PR | | 50 | 243 | PF-N31-(AGA)29-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22- PR | | 51 | 246 | PF-N31-(AGA)28-(GGA-AGA)7-(AGA)2-GGA-(AGA)6-N22-PR, PF-N31-(AGA)30-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22-PR, PF-N31-(AGA)32-(GGA-AGA)5-(AGA)2-GGA-(AGA)6-N22-PR | | 52 | 249 | PF-N31-(AGA)31-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22-PR | | 53 | 252 | PF-N31-(AGA)32-(GGA-AGA)6-(AGA)2-GGA-(AGA)6-N22-PR |
| Comment: |
PF: sequence of primer PF (20 bp), PR: complementary sequence of primer PR (20 bp), N31: AGAGAGGAGAAGAAGGAGAAGGAGGAGAAGG, N22: CNGGGAACGAAGGAGCAAAAAT (differences to GDB sequence are underlined), |
| K562 (BRL) | 52 | | K562 (Promega) | 52 | | NA3657 | 55 | | NA9947A | 45, 47 | | NA9948 | 49 |
Population dataThe values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.| 1 | Austria | Wiegand... | 0.9169 | 0.9223 | 0.8464 | 0.9212 | 0.9169 | 0.8515 | 0.9886 | 0.9223 | | 2 | Finland | Vauhkon... | 0.9107 | 0.9168 | 0.8310 | 0.9107 | 0.9107 | 0.8415 | 0.9870 | 0.9168 | | 3 | Germany | Edelman... | 0.9161 | 0.9215 | 0.8410 | 0.9161 | 0.9161 | 0.8503 | 0.9884 | 0.9215 | | 4 | Germany | Fracass... | 0.9157 | 0.9212 | 0.8412 | 0.9168 | 0.9157 | 0.8497 | 0.9883 | 0.9212 | | 5 | Germany | Tabbada... | 0.9085 | 0.9147 | 0.8279 | 0.9088 | 0.9085 | 0.8382 | 0.9865 | 0.9147 | | 6 | Germany (North East) | Poetsch... | 0.9081 | 0.9145 | 0.8267 | 0.9081 | 0.9081 | 0.8376 | 0.9863 | 0.9145 | | 7 | Germany (South) | Wiegand... | 0.8971 | 0.9045 | 0.8075 | 0.8960 | 0.8971 | 0.8208 | 0.9834 | 0.9045 | | 8 | Italy (Tuscany) | Toni C,... | 0.9064 | 0.9130 | 0.8245 | 0.9074 | 0.9064 | 0.8347 | 0.9858 | 0.9130 | | 9 | Latvia | Poetsch... | 0.8975 | 0.9050 | 0.8088 | 0.8977 | 0.8975 | 0.8212 | 0.9834 | 0.9050 | | 10 | Portugal (North) | Pereira... | 0.9123 | 0.9181 | 0.8344 | 0.9122 | 0.9123 | 0.8444 | 0.9875 | 0.9181 | | 11 | Spain (Basque country) | Zarrabe... | 0.9067 | 0.9131 | 0.8236 | 0.9056 | 0.9067 | 0.8355 | 0.9860 | 0.9131 | | 12 | Spain (Cantabria) | Zarrabe... | 0.9196 | 0.9246 | 0.8471 | 0.9196 | 0.9196 | 0.8559 | 0.9893 | 0.9246 | | 13 | Spain (Valencia) | Aler M,... | 0.9182 | 0.9234 | 0.8444 | 0.9180 | 0.9182 | 0.8536 | 0.9889 | 0.9234 | | 14 | Taiwan | Chen MY... | 0.8976 | 0.9053 | 0.8079 | 0.8976 | 0.8976 | 0.8209 | 0.9833 | 0.9053 |
| 1 |
Austria |
Caucasian (European) |
Wiegand... |
270 females |
|
0.0080 |
|
0.0230 |
0.0340 |
0.0410 |
0.0490 |
0.0530 |
0.0830 |
0.0800 |
0.1050 |
0.1200 |
0.1020 |
0.0860 |
0.0800 |
0.0610 |
0.0410 |
0.0260 |
0.0040 |
0.0040 |
0.0040 |
|
|
|
|
| 2 |
Finland |
Caucasian |
Vauhkon... |
103 |
|
|
|
0.0070 |
|
0.0070 |
0.0270 |
0.0270 |
0.0680 |
0.0680 |
0.0540 |
0.1160 |
0.1160 |
0.1090 |
0.1090 |
0.0950 |
0.0680 |
0.0610 |
0.0340 |
0.0130 |
0.0070 |
|
0.0070 |
|
0.0070 |
| 3 |
Germany |
Caucasian (European) |
Edelman... |
557 |
|
0.0070 |
0.0100 |
0.0240 |
0.0310 |
0.0440 |
0.0430 |
0.0500 |
0.0690 |
0.0920 |
0.1100 |
0.1130 |
0.1270 |
0.0820 |
0.0630 |
0.0600 |
0.0400 |
0.0140 |
0.0140 |
0.0050 |
0.0010 |
0.0010 |
|
|
|
| 4 |
Germany |
Area of Münster |
Fracass... |
217 both |
|
|
|
|
|
0.0070 |
0.0170 |
0.0310 |
0.0140 |
0.0480 |
0.0510 |
0.0680 |
0.0750 |
0.0880 |
0.1020 |
0.0750 |
0.1160 |
0.1160 |
0.0920 |
0.0440 |
0.0270 |
0.0100 |
0.0100 |
0.0100 |
|
| 5 |
Germany |
Caucasian (European) |
Tabbada... |
105 |
|
|
|
|
0.0313 |
0.0125 |
0.0250 |
0.0500 |
0.0500 |
0.0438 |
0.1000 |
0.0875 |
0.1063 |
0.1500 |
0.1063 |
0.0875 |
0.0563 |
0.0375 |
0.0125 |
0.0375 |
0.0063 |
|
|
|
|
| 6 |
Germany (North East) |
Caucasian (European) |
Poetsch... |
205 |
|
|
|
0.0070 |
|
0.0160 |
0.0200 |
0.0430 |
0.0750 |
0.0490 |
0.0890 |
0.0950 |
0.0980 |
0.1050 |
0.1080 |
0.1380 |
0.0620 |
0.0430 |
0.0160 |
0.0200 |
0.0160 |
|
|
|
|
| 7 |
Germany (South) |
Caucasian (European) |
Wiegand... |
220 females |
|
0.0050 |
0.0140 |
0.0180 |
0.0180 |
0.0640 |
0.0450 |
0.0360 |
0.0320 |
0.0950 |
0.1180 |
0.1820 |
0.1140 |
0.0950 |
0.0730 |
0.0450 |
0.0180 |
0.0180 |
|
0.0090 |
|
|
|
|
|
| 8 |
Italy (Tuscany) |
Caucasian |
Toni C,... |
160 |
|
0.0040 |
0.0040 |
0.0040 |
0.0170 |
0.0420 |
0.0710 |
0.0710 |
0.0670 |
0.0880 |
0.1250 |
0.1330 |
0.1080 |
0.0960 |
0.0750 |
0.0460 |
0.0170 |
0.0170 |
0.0080 |
0.0040 |
0.0040 |
|
|
|
|
| 9 |
Latvia |
Caucasian (European) |
Poetsch... |
152 |
|
|
|
|
0.0068 |
0.0068 |
0.0270 |
0.0473 |
0.0203 |
0.0676 |
0.0743 |
0.0676 |
0.1689 |
0.1284 |
0.1149 |
0.1014 |
0.0608 |
0.0608 |
0.0135 |
0.0270 |
0.0068 |
|
|
|
|
| 10 |
Portugal (North) |
all |
Pereira... |
347 males |
|
|
0.0029 |
0.0115 |
0.0115 |
0.0202 |
0.0403 |
0.0288 |
0.0576 |
0.0432 |
0.0749 |
0.0980 |
0.1009 |
0.1239 |
0.1210 |
0.1153 |
0.0317 |
0.0519 |
0.0231 |
0.0144 |
0.0173 |
0.0115 |
|
|
|
| 11 |
Spain (Basque country) |
Caucasian (European) |
Zarrabe... |
147 |
|
0.0080 |
0.0040 |
0.0080 |
0.0330 |
0.0330 |
0.0330 |
0.0420 |
0.0710 |
0.1130 |
0.1040 |
0.1040 |
0.0830 |
0.1540 |
0.0920 |
0.0330 |
0.0210 |
0.0380 |
0.0130 |
0.0080 |
0.0040 |
|
|
|
|
| 12 |
Spain (Cantabria) |
Caucasian (European) |
Zarrabe... |
244 |
|
0.0120 |
0.0140 |
0.0200 |
0.0260 |
0.0630 |
0.0490 |
0.0630 |
0.0950 |
0.0690 |
0.1040 |
0.1100 |
0.0810 |
0.1120 |
0.0520 |
0.0580 |
0.0320 |
0.0200 |
0.0170 |
|
0.0030 |
|
|
|
|
| 13 |
Spain (Valencia) |
all |
Aler M,... |
145 females |
|
|
|
0.0034 |
0.0207 |
0.0172 |
0.0414 |
0.0448 |
0.0552 |
0.0828 |
0.1069 |
0.0724 |
0.0862 |
0.1000 |
0.1207 |
0.0862 |
0.0448 |
0.0517 |
0.0310 |
0.0172 |
0.0138 |
0.0034 |
|
|
|
| 14 |
Taiwan |
all |
Chen MY... |
450 |
0.0030 |
|
0.0020 |
|
0.0030 |
0.0090 |
0.0190 |
0.0310 |
0.0820 |
0.0700 |
0.1350 |
0.1230 |
0.1260 |
0.1200 |
0.0890 |
0.0630 |
0.0650 |
0.0410 |
0.0120 |
0.0070 |
|
|
|
|
|
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.
References
- Aler A, Sanchez-Diz P, Gomes I, Gisbert M, Carracedo A, Amorim A, Gusmao L (2007) Genetic data of 1...
- Asamura H, Sakai H, Ota M, Fukushima H (2006) Japanese population data for eight X-STR loci using t...
- Chen MY, Pu CE (2004) Population data on the X chromosome short tandem repeat loci DXS10011, DXS101...
- Edelmann J, Deichsel D, Hering S, Plate I, Szibor R (2002) Sequence variation and allele nomenclatu...
- Edelmann J, Deichsel D, Plate I, Kaser M, Szibor R (2003) Validation of the X-chromosomal STR DXS68...
- Edelmann J, Szibor R (2003) The X-linked STRs DXS7130 and DXS6803. Forensic Science International 1...
- Fracasso T, Schurenkamp M, Brinkmann B, Hohoff C (2008) An X-STR meiosis study in Kurds and Germans...
- Gomes I, Alves C, Maxzud K, Pereira R, Prata MJ, Sanchez-Diz P, Carracedo A, Amorim A, Gusmao L (20...
- Gomes I, Prinz M, Pereira R, Meyers C, Mikulasovich RS, Amorim A, Carracedo A, Gusmao L (2007) Gene...
- Gu SZ, Li SB (2006) X-chromosome STRs analysis of Ewenke ethnic population. Forensic Science Intern...
- Hering S, Brundirs N, Kuhlisch E, Edelmann J, Plate I, Benecke M, Van PH, Michael M, Szibor R (2004...
- Hu LJ, Laporte J, Kioschis P, Heyberger S, Kretz C, Poustka A, Mandel JL, Dahl N (1996) X-linked my...
- Lee HY, Park MJ, Jeong CK, Lee SY, Yoo JE, Chung U, Choi JH, Kim CY, Shin KJ (2004) Genetic charact...
- Liu QB, Li SB (2006) Patterns of genetic polymorphism at the 10 X-chromosome STR loci in Mongol pop...
- Moreno MA, Builes JJ, Jaramillo P, Espinal C, Aguirre D, Bravo ML (2005) Allele frequency distribut...
- Peloso G, Grignani P, Previdere C (2004) Allele distribution of five X-chromosome STR loci in an It...
- Pereira R, Gomes I, Amorim A, Gusmao L (2007) Genetic diversity of 10 X chromosome STRs in northern...
- Pico A, Castillo A, Vargas C, Amorim A, Gusmao L (2008) Genetic profile characterization and segreg...
- Poetsch M, El-Mostaqim D, Tschentscher F, Browne E, Timmann C, Horstmann R, von Wurmb-Schwark N (20...
- Poetsch M, Petersmann H, Repenning A, Lignitz E (2005) Development of two pentaplex systems with X-...
- Poetsch M, Sabule A, Petersmann H, Volksone V, Lignitz E (2006) Population data of 10 X-chromosomal...
- Robino C, Giolitti A, Gino S, Torre C (2006) Development of two multiplex PCR systems for the analy...
- Schmidt W, Jenderny J, Hecher K, Hackeloer BJ, Kerber S, Kochhan L, Held KR (2000) Detection of ane...
- Shin KJ, Kwon BK, Lee SS, Yoo JE, Park MJ, Chung U, Lee HY, Han GR, Choi JH, Kim CY (2004) Five hig...
- Shin SH, Yu JS, Park SW, Min GS, Chung KW (2005) Genetic analysis of 18 X-linked short tandem repea...
- Szibor R (2007) X-chromosomal markers: past, present and future. Forensic Sci Int Genet 1:93-99
- Szibor R, Edelmann J, Hering S, Plate I, Wittig H, Roewer L, Wiegand P, Cali F, Romano V, Michael M...
- Szibor R, Edelmann J, Zarrabeitia MT, Riancho JA (2003) Sequence structure and population data of t...
- Szibor R, Krawczak M, Hering S, Edelmann J, Kuhlisch E, Krause D (2003) Use of X-linked markers for...
- Tabbada KA, De Ungria MC, Faustino LP, Athanasiadou D, Stradmann-Bellinghausen B, Schneider PM (200...
- Tariq MA, Ullah O, Riazuddin SA, Riazuddin S (2008) Allele frequency distribution of 13 X-chromosom...
- Toni C, Presciuttini S, Spinetti I, Domenici R (2003) Population data of four X-chromosome markers ...
- Turrina S, Atzei R, Filippini G, De Leo D (2007) Development and forensic validation of a new multi...
- Valle Y, Padilla-Gutierrez JR, Rodarte K, Quintero-Ramos A, Ortiz R, Hernandez-Zaragoza G, Rivas F ...
- Vauhkonen H, Vauhkonen M, Sipponen P, Sajantila A (2004) Correlation between the allelic distributi...
- Wiegand P, Berger B, Edelmann J, Parson W (2003) Population genetic comparisons of three X-chromoso...
- Zarrabeitia MT, Alonso A, Zarrabeitia A, Castro A, Fernandez I, de Pancorbo MM (2004) X-linked micr...
- Zarrabeitia MT, Amigo T, Sanudo C, de Pancorbo MM, Riancho JA (2002) Sequence structure and populat...
- Zarrabeitia MT, Amigo T, Sanudo C, Zarrabeitia A, Gonzalez-Lamuno D, Riancho JA (2002) A new pentap...
- Edelmann J, Lessig R, Hering S, Horn LC (2004) Loss of heterozygosity and microsatellite instabilit...
- Lee KL, Han MS, Jo BH, Park SW, Heo KB, Chung KW (2008) Development of two hexaplex systems with X-...
NoteNo data.
|
 |
News
Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.
|
|
