|
Marker DXS6800
Create date: |
Jun 25, 2009 12:18:13 PM |
Last update: |
Jul 4, 2012 11:23:20 AM |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif) |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif) |
Cytogenetic localisation: |
q 13.30 |
Physical localisation NCBI 36: |
78.567 |
Genetic localisation deCODE: |
86.84 |
Rutgers Map v.2: |
97.49 |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif) |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif) |
Reference: |
Edelmann J, Hering, S, Michael, M, Lessig, R, Deichsel, D, Meier-Sundhausen, G,... |
Primer
PrimerF: |
5' - |
GTGGGACCTTGTGATTGTGT |
- 3' |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif)
PrimerR: |
5' - |
CTGGCTGACACTTAGGGAAA |
- 3' |
Typical structure16 | 194 | PF-N36-(TAGA)5-CA-(GATA)1-GAT-(GATA)4-GG-(TAGA)3-TC-(GATA)3-N45-PR | 17 | 198 | PF-N36-(TAGA)7-CA-(GATA)1-GAT-(GATA)3-GG-(TAGA)3-TC-(GATA)3-N45-PR | 18 | 202 | PF-N36-(TAGA)7-CA-(GATA)1-GAT-(GATA)4-GG-(TAGA)3-TC-(GATA)3-N45-PR | 19 | 206 | PF-N36-(TAGA)8-CA-(GATA)1-GAT-(GATA)4-GG-(TAGA)3-TC-(GATA)3-N45-PR | 20 | 210 | PF-N36-(TAGA)9-CA-(GATA)1-GAT-(GATA)4-GG-(TAGA)3-TC-(GATA)3-N45-PR | 21 | 214 | PF-N36-(TAGA)10-CA-(GATA)1-GAT-(GATA)4-GG-(TAGA)3-TC-(GATA)3-N45-PR | 22 | 218 | PF-N36-(TAGA)11-CA-(GATA)1-GAT-(GATA)4-GG-(TAGA)3-TC-(GATA)3-N45-PR |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif)
Comment: |
PF: sequence of primer PF (20 bp), PR: complementary sequence of primer PR (20 bp), N36: GAGTTTAATACTCCTTAATAAATTCTCCTTTATATC, N45: TCAGGGGAACCAGCCCCCAATATTTCAACGTAGGTTCTTTTCTAT. |
K562 (BRL) | 21 | K562 (Promega) | 21 | NA3657 | 21 | NA9947A | 18, 19 | NA9948 | 19 |
Population dataThe values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.1 | Austria | Wiegand... | 0.6891 | 0.7322 | 0.5096 | 0.6962 | 0.6891 | 0.5497 | 0.8852 | 0.7322 | 2 | Germany | Edelman... | 0.6904 | 0.7314 | 0.5087 | 0.6904 | 0.6904 | 0.5519 | 0.8868 | 0.7314 | 3 | Germany | Fracass... | 0.6610 | 0.7087 | 0.4721 | 0.6610 | 0.6610 | 0.5194 | 0.8675 | 0.7087 | 4 | Germany (South) | Wiegand... | 0.6613 | 0.7043 | 0.4757 | 0.6613 | 0.6613 | 0.5191 | 0.8695 | 0.7043 | 5 | Korea | Shin SH... | 0.2513 | 0.2648 | 0.1384 | 0.2491 | 0.2513 | 0.1488 | 0.4460 | 0.2648 |
1 |
Austria |
Caucasian (European) |
Wiegand... |
270 females |
|
0.3530 |
0.0380 |
0.1320 |
0.3360 |
0.0190 |
0.1020 |
0.0260 |
|
2 |
Germany |
Caucasian (European) |
Edelman... |
559 |
|
0.3680 |
0.0520 |
0.0820 |
0.3350 |
0.0460 |
0.0940 |
0.0230 |
|
3 |
Germany |
Area of Münster |
Fracass... |
217 both |
|
0.3750 |
0.0560 |
0.0560 |
0.3620 |
0.0170 |
0.1120 |
0.0220 |
|
4 |
Germany (South) |
Caucasian (European) |
Wiegand... |
216 females |
|
0.4400 |
0.0320 |
0.0970 |
0.2870 |
0.0280 |
0.0880 |
0.0280 |
|
5 |
Korea |
Asian (Korean) |
Shin SH... |
401 |
0.0020 |
0.8520 |
|
0.0050 |
0.0820 |
|
0.0060 |
0.0500 |
0.0010 |
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.
References
- Edelmann J, Deichsel D, Hering S, Plate I, Szibor R (2002) Sequence variation and allele nomenclatu...
- Edelmann J, Szibor R (2003) The X-linked STRs DXS7130 and DXS6803. Forensic Science International 1...
- Fracasso T, Schurenkamp M, Brinkmann B, Hohoff C (2008) An X-STR meiosis study in Kurds and Germans...
- Moreno MA, Builes JJ, Jaramillo P, Espinal C, Aguirre D, Bravo ML (2005) Allele frequency distribut...
- Poetsch M, El-Mostaqim D, Tschentscher F, Browne E, Timmann C, Horstmann R, von Wurmb-Schwark N (20...
- Robino C, Giolitti A, Gino S, Torre C (2006) Development of two multiplex PCR systems for the analy...
- Rodrigues EMR, Leite FPDN, Hutz MH, Palha TDBF, dos Santos AKCR, dos Santos SEB (2008) A multiplex ...
- Shin SH, Yu JS, Park SW, Min GS, Chung KW (2005) Genetic analysis of 18 X-linked short tandem repea...
- Sood AK, Holmes R, Hendrix MJC, Buller RE (2001) Application of the National Cancer Institute inter...
- Stambolian D, Ciner EB, Reider LC, Moy C, Dana D, Owens R, Schlifka M, Holmes T, Ibay G, Bailey-Wil...
- Szibor R (2007) X-chromosomal markers: past, present and future. Forensic Sci Int Genet 1:93-99
- Szibor R, Edelmann J, Hering S, Plate I, Wittig H, Roewer L, Wiegand P, Cali F, Romano V, Michael M...
- Szibor R, Krawczak M, Hering S, Edelmann J, Kuhlisch E, Krause D (2003) Use of X-linked markers for...
- Wiegand P, Berger B, Edelmann J, Parson W (2003) Population genetic comparisons of three X-chromoso...
- Edelmann J, Lessig R, Hering S, Horn LC (2004) Loss of heterozygosity and microsatellite instabilit...
- Lee SD, Ahn JS, Zhang YJ, Shin CH, Lee YS, Lee JB (2002) X chromosome polymorphism in Koreans on DX...
NoteNo data.
|
![](/xdb/skins/img/ajaxProcess.gif;jsessionid=6C2DDBD3D4C72CACE2EE9DA49ADD17AF) |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif)
News
Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.
|
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif) |