|
Marker DXS6789
Primer
PrimerF: |
5' - |
GTTGGTACTTAATAAACCCTCTTT |
- 3' |

PrimerR: |
5' - |
AAGAAGTTATTTGATGTCCTATTGT |
- 3' |
 |
 |
Comment: |
When the promised primers are used alleles 14-25 exhibit 154-198 bps. |
Typical structureNo repeat structure data.
K562 (BRL) | 21 | K562 (Promega) | 21 | NA3657 | 23 | NA9947A | 21, 22 | NA9948 | 20 |

References: |
Szibor R, Edelmann J, Hering S, Plate I, Wittig H, Roewer L, Wiegand P, Cali F,...
Hering S, Kuhlisch E, Szibor R (2001) Development of the X-linked tetrameric mi...
|
Population dataThe values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.1 | Belo Horizonte, Brazil | Genetic... | 0.7861 | 0.8099 | 0.6332 | 0.7857 | 0.7861 | 0.6657 | 0.9401 | 0.8099 | 2 | Germany | Tabbada... | 0.7039 | 0.7394 | 0.5300 | 0.7042 | 0.7039 | 0.5677 | 0.8966 | 0.7394 | 3 | Germany (East) | Hering ... | 0.6922 | 0.7352 | 0.5050 | 0.6922 | 0.6922 | 0.5530 | 0.8869 | 0.7352 | 4 | Germany (East) | Hering ... | 0.7047 | 0.7433 | 0.5242 | 0.7047 | 0.7047 | 0.5676 | 0.8955 | 0.7433 | 5 | Germany (East) | Hering ... | 0.7016 | 0.7413 | 0.5194 | 0.7016 | 0.7016 | 0.5639 | 0.8933 | 0.7413 | 6 | Korea | Shin SH... | 0.7896 | 0.8144 | 0.6343 | 0.7885 | 0.7896 | 0.6696 | 0.9408 | 0.8144 | 7 | Philippine | Tabbada... | 0.7120 | 0.7478 | 0.5339 | 0.7122 | 0.7120 | 0.5755 | 0.9006 | 0.7478 | 8 | Portugal (North) | Pereira... | 0.6935 | 0.7283 | 0.5160 | 0.6937 | 0.6935 | 0.5545 | 0.8914 | 0.7283 | 9 | Rio de Janeiro, Brazil | Genetic... | 0.7790 | 0.8052 | 0.6219 | 0.7790 | 0.7790 | 0.6566 | 0.9359 | 0.8052 | 10 | Spain (Valencia) | Aler M,... | 0.7054 | 0.7442 | 0.5232 | 0.7053 | 0.7054 | 0.5679 | 0.8958 | 0.7442 | 11 | São Paulo, Brazil | Genetic... | 0.7880 | 0.8122 | 0.6348 | 0.7879 | 0.7880 | 0.6678 | 0.9405 | 0.8122 | 12 | Taiwan | Chen MY... | 0.7499 | 0.7794 | 0.5850 | 0.7511 | 0.7499 | 0.6207 | 0.9219 | 0.7794 | 13 | Vitória, Brazil | Genetic... | 0.7576 | 0.7857 | 0.5950 | 0.7576 | 0.7576 | 0.6303 | 0.9259 | 0.7857 |
1 |
Belo Horizonte, Brazil |
admixed |
Genetic... |
245 |
|
0.0028 |
0.1217 |
0.0680 |
0.0058 |
0.0084 |
0.0426 |
0.3114 |
0.2209 |
0.1302 |
0.0766 |
0.0112 |
|
|
2 |
Germany |
Caucasian (European) |
Tabbada... |
105 |
|
0.0063 |
0.0563 |
0.0375 |
|
|
0.0438 |
0.4000 |
0.2875 |
0.0875 |
0.0563 |
0.0250 |
|
|
3 |
Germany (East) |
Caucasian (European) |
Hering ... |
250 males |
|
0.0040 |
0.0400 |
0.0120 |
|
|
0.0400 |
0.3680 |
0.2920 |
0.1960 |
0.0480 |
|
|
|
4 |
Germany (East) |
Caucasian (European) |
Hering ... |
315 females |
|
0.0020 |
0.0350 |
0.0140 |
0.0020 |
0.0030 |
0.0250 |
0.3760 |
0.2840 |
0.1650 |
0.0700 |
0.0220 |
0.0020 |
|
5 |
Germany (East) |
Caucasian (European) |
Hering ... |
565 |
|
0.0020 |
0.0360 |
0.0140 |
0.0010 |
0.0020 |
0.0300 |
0.3740 |
0.2860 |
0.1740 |
0.0640 |
0.0160 |
0.0010 |
|
6 |
Korea |
Asian (Korean) |
Shin SH... |
401 |
0.0040 |
0.0010 |
0.1510 |
0.2820 |
0.0410 |
|
0.0380 |
0.1850 |
0.2000 |
0.0750 |
0.0160 |
0.0050 |
0.0010 |
|
7 |
Philippine |
Asian |
Tabbada... |
115 |
|
|
0.2254 |
0.3931 |
0.0867 |
|
0.0173 |
0.1908 |
0.0405 |
0.0289 |
0.0116 |
0.0058 |
|
|
8 |
Portugal (North) |
all |
Pereira... |
347 males |
|
|
0.0519 |
0.0231 |
|
|
0.0202 |
0.4352 |
0.2305 |
0.1354 |
0.0836 |
0.0144 |
0.0029 |
0.0029 |
9 |
Rio de Janeiro, Brazil |
admixed |
Genetic... |
261 |
|
0.0074 |
0.1034 |
0.0616 |
0.0025 |
0.0049 |
0.0493 |
0.2906 |
0.2438 |
0.1773 |
0.0493 |
0.0074 |
0.0025 |
|
10 |
Spain (Valencia) |
all |
Aler M,... |
145 females |
|
0.0069 |
0.0172 |
0.0172 |
0.0034 |
|
0.0345 |
0.3828 |
0.2241 |
0.2276 |
0.0724 |
0.0138 |
|
|
11 |
São Paulo, Brazil |
admixed |
Genetic... |
250 |
|
0.0121 |
0.0821 |
0.1376 |
0.0097 |
0.0048 |
0.0362 |
0.3019 |
0.2005 |
0.1667 |
0.0362 |
0.0121 |
|
|
12 |
Taiwan |
all |
Chen MY... |
447 |
|
0.0050 |
0.1680 |
0.3540 |
0.0570 |
|
0.0330 |
0.2270 |
0.0930 |
0.0480 |
0.0160 |
|
|
|
13 |
Vitória, Brazil |
admixed |
Genetic... |
245 |
|
0.0074 |
0.1012 |
0.0568 |
0.0025 |
0.0049 |
0.0593 |
0.3407 |
0.2494 |
0.1309 |
0.0420 |
0.0049 |
|
|
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.
References
- Aler A, Sanchez-Diz P, Gomes I, Gisbert M, Carracedo A, Amorim A, Gusmao L (2007) Genetic data of 1...
- Asamura H, Sakai H, Kobayashi K, Ota M, Fukushima H (2006) MiniX-STR multiplex system population st...
- Bini C, Ceccardi S, Ferri G, Pelotti S, Alu M, Roncaglia E, Beduschi G, Caenazzo L, Ponzano E, Tasi...
- Chen MY, Pu CE (2004) Population data on the X chromosome short tandem repeat loci DXS10011, DXS101...
- Edelmann J, Hering, S, Michael, M, Lessig, R, Deichsel, D, Meier-Sundhausen, G, Roewer, L, Plate, I...
- Edelmann J, Szibor R (2005) Validation of the X-linked STR DXS6801. Forensic Science International ...
- Gauthier J, Joober R, Dube MP, St-Onge J, Bonnel A, Gariepy D, Laurent S, Najafee R, Lacasse H, St-...
- Gomes I, Alves C, Maxzud K, Pereira R, Prata MJ, Sanchez-Diz P, Carracedo A, Amorim A, Gusmao L (20...
- Gomes I, Prinz M, Pereira R, Meyers C, Mikulasovich RS, Amorim A, Carracedo A, Gusmao L (2007) Gene...
- Gu SZ, Li SB (2006) X-chromosome STRs analysis of Ewenke ethnic population. Forensic Science Intern...
- Kang LL, Li SB (2006) X-chromosome STR polymorphism of Luoba Ethnic Group living in Tibet (SW China...
- Liu QB, Li SB (2006) Patterns of genetic polymorphism at the 10 X-chromosome STR loci in Mongol pop...
- Liu QL, Lv DJ, Wu XL, Sun HY, Wu XY, Lu HL (2008) Development of a five ChX STRs loci typing system...
- Lv M, Zhang L, Liang WB, Zhou B, Liao M, Wu MY (2004) Allele frequency distribution of two X-chromo...
- Lv ML, Liang WB, Wu MY, Liao M, Zhou B, Jia Y, Zhang L (2004) Allele frequency distribution of two ...
- Peloso G, Grignani P, Previdere C (2004) Allele distribution of five X-chromosome STR loci in an It...
- Pereira R, Gomes I, Amorim A, Gusmao L (2007) Genetic diversity of 10 X chromosome STRs in northern...
- Pico A, Castillo A, Vargas C, Amorim A, Gusmao L (2008) Genetic profile characterization and segreg...
- Robino C, Giolitti A, Gino S, Torre C (2006) Development of two multiplex PCR systems for the analy...
- Rodrigues EMR, Leite FPDN, Hutz MH, Palha TDBF, dos Santos AKCR, dos Santos SEB (2008) A multiplex ...
- Schmidt D, Hummel S, Herrmann B (2003) Brief communication: Multiplex X/Y-PCR improves sex identifi...
- Schurmann M, Reichel P, Muller-Myhsok B, Schlaak M, Muller-Quernheim J, Schwinger E (2001) Results ...
- Shin SH, Yu JS, Park SW, Min GS, Chung KW (2005) Genetic analysis of 18 X-linked short tandem repea...
- Son JY, Lee YS, Choung CM, Lee SD (2002) Polymorphism of nine X chromosomal STR loci in Koreans. In...
- Stambolian D, Ciner EB, Reider LC, Moy C, Dana D, Owens R, Schlifka M, Holmes T, Ibay G, Bailey-Wil...
- Szibor R (2007) X-chromosomal markers: past, present and future. Forensic Sci Int Genet 1:93-99
- Szibor R, Edelmann J, Hering S, Plate I, Wittig H, Roewer L, Wiegand P, Cali F, Romano V, Michael M...
- Szibor R, Hering S, Kuhlisch E, Plate I, Demberger S, Krawczak M, Edelmann J (2005) Haplotyping of ...
- Szibor R, Krawczak M, Hering S, Edelmann J, Kuhlisch E, Krause D (2003) Use of X-linked markers for...
- Tabbada KA, De Ungria MC, Faustino LP, Athanasiadou D, Stradmann-Bellinghausen B, Schneider PM (200...
- Tariq M, Sabir M, Riazuddin S, Riazuddin S (2009) Haplotype analysis of two X-chromosome STR cluste...
- Tariq MA, Ullah O, Riazuddin SA, Riazuddin S (2008) Allele frequency distribution of 13 X-chromosom...
- Turrina S, Atzei R, Filippini G, De Leo D (2007) Development and forensic validation of a new multi...
- Yu B, Zhang HB, Li SB (2005) X-chromosome STRs polymorphisms of Han ethnic group from Northwest Chi...
- Zarrabeitia MT, Alonso A, Martin J, Gonzalez-Gay MA, Martin-Escudero JC, de Pancorbo MM, Sanz P, Ru...
- Bini C, Ceccardi S, Ferri G, Pelotti S, Alu M, Roncaglia E, Beduschi G, Caenazzo L, Ponzano E, Tasi...
- Lee KL, Han MS, Jo BH, Park SW, Heo KB, Chung KW (2008) Development of two hexaplex systems with X-...
NoteNo data.
|
 |

News
Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.
|
 |