ChrX-STR.org 2.0
Database and information hub for forensic X-chromosomal markers

Marker HPRTB

Create date:	Jun 25, 2009 12:18:14 PM
Last update:	Jul 13, 2011 9:42:29 AM

Linkage group:	X3
Cytogenetic localisation:	q 26.20
Physical localisation NCBI 36:	133.443
Rutgers Map v.2:	149.66

Reference:	Hearne CM, Todd JA (1991) Tetranucleotide repeat polymorphism at the HPRT locus...

Primer

PrimerF:

5' -

TCTCTATTTCCATCTCTGTCTCC

- 3'

PrimerR:

5' -

TCACCCCTGTCTATGGTCTCG

- 3'

Typical structure

Allele	bps	Sequence composition
9-17	144-176	PF N30 (TCTA)n N34 PR

Comment:

Typical Sequence composition, N= Nucleotid, Allele variants are known

References:

Mertens G, Gielis M, Mommers N, Mularoni A, Lamartine J, Heylen H, Muylle L, Va...

Cell line DNA	Allele
K562 (BRL)	13
K562 (Promega)	13
NA3657	13
NA9947A	14, 14
NA9948	14

References:

Szibor R, Edelmann J, Hering S, Plate I, Wittig H, Roewer L, Wiegand P, Cali F,...

Population data

The values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.

ID	Population	Reference	PIC	HET	MEC Krüger	MEC Kishida	MEC Desmarais	MEC Desmarais duo	PD female	PD male
1	Argentina (Buenos Aires)	Sala, A...	0.7283	0.7654	0.5458	0.7259	0.7283	0.5938	0.9078	0.7654
2	Brazil (Pernambuco)	Maurici...	0.7233	0.7612	0.5434	0.7245	0.7233	0.5881	0.9051	0.7612
3	China (Guangdong)	Genetic...	0.6814	0.7234	0.4922	0.6814	0.6814	0.5397	0.8815	0.7234
4	Chinese	Tabbada...	0.6572	0.7084	0.4601	0.6572	0.6572	0.5138	0.8637	0.7084
5	Germany	Becker ...	0.6974	0.7389	0.5123	0.6970	0.6974	0.5590	0.8904	0.7389
6	Germany	Becker ...	0.6881	0.7322	0.4989	0.6876	0.6881	0.5481	0.8842	0.7322
7	Germany	Becker ...	0.6944	0.7367	0.5080	0.6940	0.6944	0.5555	0.8884	0.7367
8	Germany	Edelman...	0.7372	0.7717	0.5620	0.7372	0.7372	0.6047	0.9134	0.7717
9	Germany (Baden-Württenberg)	Szibor ...	0.7326	0.7680	0.5512	0.7279	0.7326	0.5992	0.9107	0.7680
10	Germany (North East)	Poetsch...	0.7008	0.7419	0.5158	0.7008	0.7008	0.5625	0.8923	0.7419
11	Ghana	Becker ...	0.7654	0.7946	0.5999	0.7653	0.7654	0.6387	0.9286	0.7946
12	Hungary	Füredi,...	0.7178	0.7551	0.5381	0.7178	0.7178	0.5821	0.9027	0.7551
13	Hungary	Zalán A...	0.7117	0.7511	0.5282	0.7106	0.7117	0.5751	0.8987	0.7511
14	Italy (Tuscany)	Toni C,...	0.6924	0.7340	0.5077	0.6924	0.6924	0.5534	0.8877	0.7340
15	Japan (Fukuoka)	Becker ...	0.6135	0.6674	0.4081	0.6008	0.6135	0.4685	0.8354	0.6674
16	Japanese	Tabbada...	0.6137	0.6601	0.4221	0.6138	0.6137	0.4668	0.8381	0.6601
17	Korea	Shin KJ...	0.6356	0.6905	0.4364	0.6368	0.6356	0.4906	0.8493	0.6905
18	Korea	Shin SH...	0.6353	0.6807	0.4439	0.6353	0.6353	0.4897	0.8526	0.6807
19	Latvia	Poetsch...	0.6949	0.7375	0.5073	0.6949	0.6949	0.5556	0.8885	0.7375
20	Mexico (Jalisco)	Rangel-...	0.7345	0.7706	0.5563	0.7346	0.7345	0.6011	0.9112	0.7706
21	Philippine	Tabbada...	0.6263	0.6692	0.4356	0.6264	0.6263	0.4793	0.8477	0.6692
22	Poland	Pepinsk...	0.6980	0.7392	0.5132	0.6980	0.6980	0.5595	0.8908	0.7392
23	Spain (Basque country)	Zarrabe...	0.6904	0.7347	0.5002	0.6904	0.6904	0.5503	0.8853	0.7347
24	Spain (Cantabria)	Zarrabe...	0.7062	0.7472	0.5185	0.7038	0.7062	0.5684	0.8951	0.7472
25	Spain (Cantabria)	Zarrabe...	0.7157	0.7560	0.5298	0.7157	0.7157	0.5787	0.9001	0.7560
26	Spain (Valencia)	Aler M,...	0.6803	0.7254	0.4892	0.6802	0.6803	0.5391	0.8795	0.7254
27	Taiwan	Chen MY...	0.6598	0.7095	0.4635	0.6598	0.6598	0.5164	0.8659	0.7095
28	Thai	Tabbada...	0.7064	0.7478	0.5200	0.7066	0.7064	0.5684	0.8950	0.7478
29	United Kingdom	Pai, A....	0.7206	0.7585	0.5402	0.7217	0.7206	0.5849	0.9037	0.7585
30	USA (Afro-Americans)	Edwards...	0.7320	0.7688	0.5531	0.7320	0.7320	0.5984	0.9097	0.7688
31	USA (Caucasian)	Edwards...	0.7112	0.7509	0.5274	0.7112	0.7112	0.5741	0.8982	0.7509
32	USA (Hispanics)	Edwards...	0.6775	0.7246	0.4837	0.6775	0.6775	0.5358	0.8770	0.7246

ID	Population	Ethnic specification	Reference	n*	6	7	8	9	10	11	11.2	12	12.2	13	14	15	16	17	18	19
1	Argentina (Buenos Aires)	Caucasoids	Sala, A...	278					0.0320	0.1790		0.3160		0.2840	0.1370	0.0470	0.0030
2	Brazil (Pernambuco)	all	Maurici...	254				0.0160	0.0200	0.1460		0.2950		0.3190	0.1650	0.0240	0.0160
3	China (Guangdong)	Asian (Chinese Han)	Genetic...	272 both						0.1000		0.2225		0.4175	0.2000	0.0525	0.0075
4	Chinese	Asian	Tabbada...	90						0.0700		0.3300		0.3800	0.1800	0.0300	0.0100
5	Germany	Caucasian (European)	Becker ...	278 females				0.0054	0.0072	0.1299	0.0054	0.3537		0.3212	0.1155	0.0487	0.0126
6	Germany	Caucasian (European)	Becker ...	439 males				0.0091	0.0023	0.1366	0.0045	0.3530		0.3280	0.1252	0.0341	0.0068
7	Germany	Caucasian (European)	Becker ...	717				0.0066	0.0055	0.1322	0.0051	0.3535		0.3235	0.1187	0.0438	0.0107
8	Germany	Caucasian (European)	Edelman...	335				0.0100	0.0190	0.1160		0.2760		0.3220	0.1690	0.0760	0.0120
9	Germany (Baden-Württenberg)	Caucasian (European)	Szibor ...	643				0.0050	0.0140	0.1310		0.2870		0.3220	0.1520	0.0730	0.0120
10	Germany (North East)	Caucasian (European)	Poetsch...	205				0.0030	0.0070	0.1180		0.3410		0.3280	0.1110	0.0890	0.0030
11	Ghana	all	Becker ...	59 males				0.0508		0.1017		0.3051		0.2373	0.1695	0.1186	0.0169
12	Hungary	all	Füredi,...	242			0.0050	0.0200	0.0100	0.1320		0.3530		0.2840	0.1370	0.0540	0.0050
13	Hungary	all	Zalán A...	384			0.0040	0.0220	0.0050	0.1130	0.0020	0.3220		0.3240	0.1580	0.0440	0.0050
14	Italy (Tuscany)	Caucasian	Toni C,...	160					0.0080	0.0170		0.1170	0.0040	0.3750	0.3080	0.1210	0.0420	0.0080
15	Japan (Fukuoka)	Asian (Japanese)	Becker ...	93 males						0.0645		0.3226		0.4624	0.0968	0.0323	0.0108
16	Japanese	Asian	Tabbada...	95 males						0.0316		0.2421		0.5053	0.1474	0.0526	0.0211
17	Korea	Asian (Korean)	Shin KJ...	300						0.0360		0.3130		0.4160	0.1890	0.0360	0.0110
18	Korea	Asian (Korean)	Shin SH...	401					0.0040	0.0510		0.2490		0.4780	0.1490	0.0630	0.0060
19	Latvia	Caucasian (European)	Poetsch...	152				0.0068	0.0135	0.1486		0.3649		0.2973	0.1351	0.0135	0.0068	0.0135
20	Mexico (Jalisco)	all	Rangel-...	173			0.0043	0.0043	0.0086	0.0730		0.2790		0.3047	0.2017	0.1116	0.0129
21	Philippine	Asian	Tabbada...	115						0.0983		0.2139		0.5029	0.1445	0.0405
22	Poland	all	Pepinsk...	240				0.0222		0.1111		0.3639		0.3056	0.1417	0.0444	0.0083	0.0028
23	Spain (Basque country)	Caucasian (European)	Zarrabe...	147				0.0050		0.0140		0.1450		0.3180	0.3500	0.1400	0.0280
24	Spain (Cantabria)	Caucasian (European)	Zarrabe...	244				0.0080		0.0080		0.1460		0.3360	0.3110	0.1430	0.0360	0.0060	0.0020	0.0020
25	Spain (Cantabria)	Caucasian (European)	Zarrabe...	131				0.0150		0.0050		0.1720		0.3180	0.2930	0.1620	0.0300	0.0050
26	Spain (Valencia)	all	Aler M,...	145 females								0.1172	0.0103	0.3828	0.3000	0.1517	0.0345	0.0034
27	Taiwan	all	Chen MY...	571						0.0736		0.2995		0.3993	0.1856	0.0385	0.0035
28	Thai	Asian	Tabbada...	157						0.1263		0.2980	0.0051	0.3384	0.1768	0.0354	0.0202
29	United Kingdom	all	Pai, A....	364				0.0030	0.0230	0.1600		0.3380		0.2820	0.1370	0.0530	0.0050
30	USA (Afro-Americans)	all	Edwards...	178	0.0040			0.0180	0.0150	0.0690		0.2570		0.3040	0.2460	0.0830	0.0040
31	USA (Caucasian)	Caucasian	Edwards...	168		0.0020		0.0050	0.0100	0.1340		0.3430		0.2950	0.1560	0.0430	0.0120
32	USA (Hispanics)	all	Edwards...	169				0.0050		0.0620		0.3000		0.3710	0.2000	0.0620

n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.

References

Note

No data.

Manage

Manage access

News

Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.

Data Protection | Imprint |