|
Marker DXS7130
Primer
PrimerF: |
5' - |
CTGCAAGCCATTTGGAATAT |
- 3' |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif)
PrimerR: |
5' - |
TCCTAGGACTGGGAAAGGAC |
- 3' |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif) |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif) |
Comment: |
DXS7130 (G00-455-823) |
Typical structure10 | 109 | PF-N19-(TCTA)10-N8-PR | 11 | 113 | PF-N19-(TCTA)11-N8-PR | 12 | 117 | PF-N19-(TCTA)12-N8-PR | 12.3 | 120 | PF-N19-(TCTA)11-(CTA)-(TCTA)1-N8-PR | 13 | 121 | PF-N19 -(TCTA)13-N8-PR | 13.3 | 124 | PF-N19-(TCTA)12-(CTA)-(TCTA)1-N8-PR | 14 | 125 | PF-N19-(TCTA)14-N8-PR | 14.3 | 128 | PF-N19-(TCTA)13-(CTA)-(TCTA)1-N8-PR |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif)
Comment: |
PF: sequence of primer PF (20 bp), PR: complementary sequence of primer PR (22 bp), N19: AAACAATATACACAGAATG, N8:TCGAGATA,. |
K562 (BRL) | 15.3 | K562 (Promega) | 15.3 | NA3657 | 17.3 | NA9947A | 15.3, 15.3 | NA9948 | 14.3 |
Population dataThe values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.1 | Germany (Western Saxonia) | Edelman... | 0.7142 | 0.7476 | 0.5390 | 0.7142 | 0.7142 | 0.5781 | 0.9029 | 0.7476 | 2 | Germany (Western Saxonia) | Edelman... | 0.7255 | 0.7532 | 0.5589 | 0.7257 | 0.7255 | 0.5916 | 0.9114 | 0.7532 | 3 | Germany (Western Saxonia) | Edelman... | 0.7235 | 0.7523 | 0.5550 | 0.7236 | 0.7235 | 0.5892 | 0.9098 | 0.7523 |
1 |
Germany (Western Saxonia) |
Caucasian (European) |
Edelman... |
192 males |
0.0104 |
0.0313 |
0.0833 |
0.0156 |
0.0469 |
0.2083 |
0.4063 |
0.1823 |
0.0156 |
|
2 |
Germany (Western Saxonia) |
Caucasian (European) |
Edelman... |
306 females |
0.0065 |
0.0458 |
0.0768 |
0.0376 |
0.0507 |
0.1830 |
0.4216 |
0.1520 |
0.0212 |
0.0049 |
3 |
Germany (Western Saxonia) |
Caucasian (European) |
Edelman... |
498 |
0.0075 |
0.0423 |
0.0784 |
0.0323 |
0.0498 |
0.1891 |
0.4179 |
0.1592 |
0.0199 |
0.0037 |
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.
References
- Edelmann J, Szibor R (2003) The X-linked STRs DXS7130 and DXS6803. Forensic Science International 1...
- Rodrigues EMR, Leite FPDN, Hutz MH, Palha TDBF, dos Santos AKCR, dos Santos SEB (2008) A multiplex ...
- Szibor R, Edelmann J, Hering S, Plate I, Wittig H, Roewer L, Wiegand P, Cali F, Romano V, Michael M...
- Zarrabeitia MT, Alonso A, Martin J, Gonzalez-Gay MA, Martin-Escudero JC, de Pancorbo MM, Sanz P, Ru...
- Edelmann J, Lessig R, Hering S, Horn LC (2004) Loss of heterozygosity and microsatellite instabilit...
NoteNo data.
|
![](/xdb/skins/img/ajaxProcess.gif;jsessionid=7151EA16A00837ADD05ABF1ECCD19C5B) |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif)
News
Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.
|
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif) |