|
Marker DXS7423
| Create date: |
Jun 25, 2009 12:18:15 PM |
| Last update: |
Jul 13, 2011 9:40:18 AM |
 |
 |
| Linkage group: |
X4 |
| Cytogenetic localisation: |
q 28.00 |
| Physical localisation NCBI 36: |
149.460 |
| Rutgers Map v.2: |
184.19 |
 |
 |
| Reference: |
Edelmann J, Hering, S, Michael, M, Lessig, R, Deichsel, D, Meier-Sundhausen, G,... |
Primer
| PrimerF: |
5' - |
GTCTTCCTGTCATCTCCCAAC |
- 3' |

| PrimerR: |
5' - |
AGCTTAGCGCCTGGCACATA |
- 3' |
Typical structure| 12-18 | 175-199 | PF-N30-(TCCA)3TCTGTCCT(TCCA)9-15-N47-PR |
| K562 (BRL) | 17 | | K562 (Promega) | 17 | | NA3657 | 13 | | NA9947A | 14, 15 | | NA9948 | 14 |
Population dataThe values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.| 1 | Belo Horizonte, Brazil | Genetic... | 0.6416 | 0.6944 | 0.4468 | 0.6416 | 0.6416 | 0.4980 | 0.8538 | 0.6944 | | 2 | China (Guangdong) | Genetic... | 0.4219 | 0.5186 | 0.2324 | 0.4219 | 0.4219 | 0.2877 | 0.6715 | 0.5186 | | 3 | Finland | Vauhkon... | 0.6619 | 0.7142 | 0.4596 | 0.6619 | 0.6619 | 0.5176 | 0.8660 | 0.7142 | | 4 | Germany | Becker ... | 0.6768 | 0.7245 | 0.4818 | 0.6765 | 0.6768 | 0.5349 | 0.8764 | 0.7245 | | 5 | Germany | Becker ... | 0.6708 | 0.7192 | 0.4755 | 0.6704 | 0.6708 | 0.5284 | 0.8727 | 0.7192 | | 6 | Germany | Becker ... | 0.6751 | 0.7229 | 0.4800 | 0.6746 | 0.6751 | 0.5331 | 0.8754 | 0.7229 | | 7 | Germany (East) | Szibor ... | 0.6557 | 0.7085 | 0.4560 | 0.6557 | 0.6557 | 0.5119 | 0.8622 | 0.7085 | | 8 | Ghana | Becker ... | 0.6411 | 0.6917 | 0.4435 | 0.6411 | 0.6411 | 0.4959 | 0.8543 | 0.6917 | | 9 | Hungary | Zalán A... | 0.6615 | 0.7119 | 0.4626 | 0.6591 | 0.6615 | 0.5183 | 0.8666 | 0.7119 | | 10 | Japan (Fukuoka) | Becker ... | 0.4367 | 0.5041 | 0.2518 | 0.4367 | 0.4367 | 0.2968 | 0.6867 | 0.5041 | | 11 | Korea | Shin SH... | 0.4481 | 0.5362 | 0.2550 | 0.4481 | 0.4481 | 0.3099 | 0.6968 | 0.5362 | | 12 | Poland | Pepinsk... | 0.6640 | 0.7126 | 0.4675 | 0.6639 | 0.6640 | 0.5205 | 0.8688 | 0.7126 | | 13 | Portugal (North) | Pereira... | 0.6173 | 0.6760 | 0.4170 | 0.6173 | 0.6173 | 0.4721 | 0.8364 | 0.6760 | | 14 | Rio de Janeiro, Brazil | Genetic... | 0.6380 | 0.6911 | 0.4434 | 0.6380 | 0.6380 | 0.4943 | 0.8515 | 0.6911 | | 15 | Spain (Basque country) | Zarrabe... | 0.6277 | 0.6854 | 0.4258 | 0.6289 | 0.6277 | 0.4821 | 0.8433 | 0.6854 | | 16 | Spain (Cantabria) | Zarrabe... | 0.6643 | 0.7129 | 0.4659 | 0.6619 | 0.6643 | 0.5210 | 0.8690 | 0.7129 | | 17 | Spain (Valencia) | Aler M,... | 0.6350 | 0.6868 | 0.4382 | 0.6349 | 0.6350 | 0.4899 | 0.8501 | 0.6868 | | 18 | São Paulo, Brazil | Genetic... | 0.5822 | 0.6424 | 0.3857 | 0.5821 | 0.5822 | 0.4365 | 0.8119 | 0.6424 | | 19 | Vitória, Brazil | Genetic... | 0.6103 | 0.6691 | 0.4116 | 0.6103 | 0.6103 | 0.4651 | 0.8317 | 0.6691 |
| 1 |
Belo Horizonte, Brazil |
admixed |
Genetic... |
245 |
|
|
0.0057 |
0.0595 |
|
0.3851 |
0.3684 |
0.1190 |
0.0623 |
|
|
| 2 |
China (Guangdong) |
Asian (Chinese Han) |
Genetic... |
272 both |
|
|
|
0.0025 |
|
0.3750 |
0.5825 |
0.0375 |
0.0025 |
|
|
| 3 |
Finland |
Caucasian |
Vauhkon... |
103 |
|
|
|
0.1290 |
|
0.3670 |
0.3130 |
0.1910 |
|
|
|
| 4 |
Germany |
Caucasian (European) |
Becker ... |
278 females |
|
|
0.0018 |
0.1263 |
|
0.3465 |
0.3375 |
0.1570 |
0.0306 |
|
|
| 5 |
Germany |
Caucasian (European) |
Becker ... |
439 males |
|
|
|
0.1366 |
0.0023 |
0.3621 |
0.3348 |
0.1343 |
0.0296 |
|
|
| 6 |
Germany |
Caucasian (European) |
Becker ... |
717 |
|
|
0.0012 |
0.1297 |
0.0007 |
0.3517 |
0.3366 |
0.1494 |
0.0303 |
|
|
| 7 |
Germany (East) |
Caucasian (European) |
Szibor ... |
620 chrx |
|
|
0.0020 |
0.0770 |
|
0.3480 |
0.3560 |
0.1930 |
0.0220 |
0.0020 |
|
| 8 |
Ghana |
all |
Becker ... |
59 males |
|
|
|
0.1864 |
|
0.4407 |
0.2712 |
0.0678 |
0.0339 |
|
|
| 9 |
Hungary |
all |
Zalán A... |
384 |
|
|
0.0020 |
0.1350 |
|
0.3420 |
0.3680 |
0.1310 |
0.0180 |
|
0.0020 |
| 10 |
Japan (Fukuoka) |
Asian (Japanese) |
Becker ... |
93 males |
|
|
|
|
|
0.2688 |
0.6452 |
0.0860 |
|
|
|
| 11 |
Korea |
Asian (Korean) |
Shin SH... |
401 |
|
|
0.0010 |
|
|
0.3560 |
0.5770 |
0.0640 |
0.0020 |
|
|
| 12 |
Poland |
all |
Pepinsk... |
240 |
|
|
|
0.1361 |
|
0.2944 |
0.4000 |
0.1472 |
0.0222 |
|
|
| 13 |
Portugal (North) |
all |
Pereira... |
347 males |
|
0.0029 |
|
0.0605 |
|
0.3573 |
0.4150 |
0.1412 |
0.0231 |
|
|
| 14 |
Rio de Janeiro, Brazil |
admixed |
Genetic... |
261 |
0.0074 |
|
0.0049 |
0.0714 |
|
0.3596 |
0.3990 |
0.1158 |
0.0419 |
|
|
| 15 |
Spain (Basque country) |
Caucasian (European) |
Zarrabe... |
147 |
|
|
|
0.0500 |
|
0.3310 |
0.4090 |
0.1860 |
0.0250 |
|
|
| 16 |
Spain (Cantabria) |
Caucasian (European) |
Zarrabe... |
125 |
|
|
|
0.0730 |
|
0.2720 |
0.4030 |
0.2090 |
0.0410 |
|
|
| 17 |
Spain (Valencia) |
all |
Aler M,... |
145 females |
|
|
0.0034 |
0.0655 |
|
0.2966 |
0.4414 |
0.1586 |
0.0310 |
|
0.0034 |
| 18 |
São Paulo, Brazil |
admixed |
Genetic... |
250 |
0.0048 |
0.0024 |
|
0.0555 |
|
0.3309 |
0.4855 |
0.0918 |
0.0290 |
|
|
| 19 |
Vitória, Brazil |
admixed |
Genetic... |
245 |
|
|
0.0049 |
0.0494 |
|
0.3531 |
0.4321 |
0.1259 |
0.0346 |
|
|
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.
References
- Aler A, Sanchez-Diz P, Gomes I, Gisbert M, Carracedo A, Amorim A, Gusmao L (2007) Genetic data of 1...
- Asamura H, Sakai H, Kobayashi K, Ota M, Fukushima H (2006) MiniX-STR multiplex system population st...
- Bini C, Ceccardi S, Ferri G, Pelotti S, Alu M, Roncaglia E, Beduschi G, Caenazzo L, Ponzano E, Tasi...
- Caine LM, Pontes L, Abrantes D, Lima G, Pinheiro F (2007) Genetic data of 4 X-chromosomal short tan...
- Caine LM, Pontes L, Abrantes D, Lima G, Pinheiro F (2007) Genetic data of four X-chromosomal STRs i...
- Catanesi CI, Martina PF, Giovambattista G, Zukas P, Vidal-Rioja L (2007) Geographic structure in gr...
- Edelmann J, Deichsel D, Hering S, Plate I, Szibor R (2002) Sequence variation and allele nomenclatu...
- Edelmann J, Deichsel D, Plate I, Kaser M, Szibor R (2003) Validation of the X-chromosomal STR DXS68...
- Edelmann J, Szibor R (2003) The X-linked STRs DXS7130 and DXS6803. Forensic Science International 1...
- Gomes I, Alves C, Maxzud K, Pereira R, Prata MJ, Sanchez-Diz P, Carracedo A, Amorim A, Gusmao L (20...
- Gomes I, Prinz M, Pereira R, Meyers C, Mikulasovich RS, Amorim A, Carracedo A, Gusmao L (2007) Gene...
- Gu SZ, Li SB (2006) X-chromosome STRs analysis of Ewenke ethnic population. Forensic Science Intern...
- Hering S, Brundirs N, Kuhlisch E, Edelmann J, Plate I, Benecke M, Van PH, Michael M, Szibor R (2004...
- Hu LJ, Laporte J, Kioschis P, Heyberger S, Kretz C, Poustka A, Mandel JL, Dahl N (1996) X-linked my...
- Kang LL, Li SB (2006) X-chromosome STR polymorphism of Luoba Ethnic Group living in Tibet (SW China...
- Liu QB, Li SB (2006) Patterns of genetic polymorphism at the 10 X-chromosome STR loci in Mongol pop...
- Moreno MA, Builes JJ, Jaramillo P, Espinal C, Aguirre D, Bravo ML (2005) Allele frequency distribut...
- Pereira R, Gomes I, Amorim A, Gusmao L (2007) Genetic diversity of 10 X chromosome STRs in northern...
- Pico A, Castillo A, Vargas C, Amorim A, Gusmao L (2008) Genetic profile characterization and segreg...
- Poetsch M, El-Mostaqim D, Tschentscher F, Browne E, Timmann C, Horstmann R, von Wurmb-Schwark N (20...
- Rodrigues EMR, Leite FPDN, Hutz MH, Palha TDBF, dos Santos AKCR, dos Santos SEB (2008) A multiplex ...
- Shin KJ, Kwon BK, Lee SS, Yoo JE, Park MJ, Chung U, Lee HY, Han GR, Choi JH, Kim CY (2004) Five hig...
- Shin SH, Yu JS, Park SW, Min GS, Chung KW (2005) Genetic analysis of 18 X-linked short tandem repea...
- Szibor R (2007) X-chromosomal markers: past, present and future. Forensic Sci Int Genet 1:93-99
- Szibor R, Edelmann J, Hering S, Plate I, Wittig H, Roewer L, Wiegand P, Cali F, Romano V, Michael M...
- Szibor R, Edelmann J, Zarrabeitia MT, Riancho JA (2003) Sequence structure and population data of t...
- Szibor R, Krawczak M, Hering S, Edelmann J, Kuhlisch E, Krause D (2003) Use of X-linked markers for...
- Tabbada KA, De Ungria MC, Faustino LP, Athanasiadou D, Stradmann-Bellinghausen B, Schneider PM (200...
- Tang WM, To KY (2006) Four X-chromosomal STRs and their allele frequencies in a Chinese population....
- Tariq MA, Ullah O, Riazuddin SA, Riazuddin S (2008) Allele frequency distribution of 13 X-chromosom...
- Turrina S, Atzei R, De Leo D (2007) Polymorphism of four X-chromosomal STRs: DXS7423, DXS7424, DXS8...
- Turrina S, Atzei R, Filippini G, De Leo D (2007) Development and forensic validation of a new multi...
- Valle Y, Padilla-Gutierrez JR, Rodarte K, Quintero-Ramos A, Ortiz R, Hernandez-Zaragoza G, Rivas F ...
- Vauhkonen H, Vauhkonen M, Sipponen P, Sajantila A (2004) Correlation between the allelic distributi...
- Yu B, Zhang HB, Li SB (2005) X-chromosome STRs polymorphisms of Han ethnic group from Northwest Chi...
- Zalan A, Volgyi A, Brabetz W, Schleinitz D, Pamjav H (2008) Hungarian population data of eight X-li...
- Zalan A, Volgyi A, Jung M, Peterman O, Pamjav H (2007) Hungarian population data of four X-linked m...
- Zarrabeitia MT, Alonso A, Zarrabeitia A, Castro A, Fernandez I, de Pancorbo MM (2004) X-linked micr...
- Zarrabeitia MT, Amigo T, Sanudo C, de Pancorbo MM, Riancho JA (2002) Sequence structure and populat...
- Zarrabeitia MT, Amigo T, Sanudo C, Zarrabeitia A, Gonzalez-Lamuno D, Riancho JA (2002) A new pentap...
- Lee KL, Han MS, Jo BH, Park SW, Heo KB, Chung KW (2008) Development of two hexaplex systems with X-...
- Peloso G, Grignani P, Previdere C (2004) Allele distribution of five X-chromosome STR loci in an It...
NoteNo data.
|
 |

News
Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.
|
 |