|
Marker DXS7133
Create date: |
Jun 25, 2009 12:18:14 PM |
Last update: |
Sep 27, 2010 2:31:38 PM |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif) |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif) |
Cytogenetic localisation: |
q 22.30 |
Physical localisation NCBI 36: |
108.928 |
Rutgers Map v.2: |
118.18 |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif) |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif) |
Reference: |
Edelmann J, Hering, S, Michael, M, Lessig, R, Deichsel, D, Meier-Sundhausen, G,... |
Primer
PrimerF: |
5' - |
AGCTTCCTTAGATGGCATTCA |
- 3' |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif)
PrimerR: |
5' - |
CTTCCAGAATCAGAAGTCTCC |
- 3' |
Typical structure7-14 | 106-132 | PF-(ATAG)9-14 N36-PR |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif)
Comment: |
N= Nucleotide, PF: sequence of primer PF (21 bp), PR: complementary sequence of primer PR (21 bp), 36: ATAAAAATAAGCATGAACACCGTTAAAAATAAAGTA |
K562 (BRL) | 10 | K562 (Promega) | 10 | NA3657 | 9 | NA9947A | 9, 10 | NA9948 | 11 |
Population dataThe values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.1 | Belo Horizonte, Brazil | Genetic... | 0.6278 | 0.6835 | 0.4282 | 0.6278 | 0.6278 | 0.4826 | 0.8441 | 0.6835 | 2 | Germany | Edelman... | 0.5753 | 0.6409 | 0.3718 | 0.5753 | 0.5753 | 0.4288 | 0.8055 | 0.6409 | 3 | Germany (North East) | Poetsch... | 0.6268 | 0.6814 | 0.4326 | 0.6280 | 0.6268 | 0.4824 | 0.8439 | 0.6814 | 4 | Italy | Turrina... | 0.6017 | 0.6630 | 0.3984 | 0.6017 | 0.6017 | 0.4554 | 0.8252 | 0.6630 | 5 | Latvia | Poetsch... | 0.6283 | 0.6887 | 0.4210 | 0.6284 | 0.6283 | 0.4824 | 0.8427 | 0.6887 | 6 | Rio de Janeiro, Brazil | Genetic... | 0.6529 | 0.7055 | 0.4535 | 0.6529 | 0.6529 | 0.5089 | 0.8606 | 0.7055 | 7 | São Paulo, Brazil | Genetic... | 0.5876 | 0.6442 | 0.3902 | 0.5875 | 0.5876 | 0.4408 | 0.8168 | 0.6442 | 8 | Vitória, Brazil | Genetic... | 0.6343 | 0.6908 | 0.4338 | 0.6343 | 0.6343 | 0.4896 | 0.8479 | 0.6908 |
1 |
Belo Horizonte, Brazil |
admixed |
Genetic... |
244 |
|
0.0057 |
0.3250 |
0.1679 |
0.4243 |
0.0456 |
0.0171 |
0.0144 |
|
2 |
Germany |
Caucasian (European) |
Edelman... |
286 |
0.0030 |
|
0.4730 |
0.1420 |
0.3370 |
0.0400 |
0.0050 |
|
|
3 |
Germany (North East) |
Caucasian (European) |
Poetsch... |
205 |
0.0070 |
0.0230 |
0.3480 |
0.1120 |
0.4230 |
0.0720 |
0.0160 |
|
|
4 |
Italy |
Caucasians |
Turrina... |
85 females |
|
|
0.4460 |
0.1630 |
0.3310 |
0.0420 |
0.0120 |
0.0060 |
|
5 |
Latvia |
Caucasian (European) |
Poetsch... |
152 |
|
0.0068 |
0.2162 |
0.3514 |
0.3716 |
0.0541 |
|
|
|
6 |
Rio de Janeiro, Brazil |
admixed |
Genetic... |
261 |
0.0049 |
0.0025 |
0.3103 |
0.2069 |
0.3892 |
0.0591 |
0.0172 |
0.0099 |
|
7 |
São Paulo, Brazil |
admixed |
Genetic... |
249 |
0.0072 |
0.0097 |
0.4999 |
0.1408 |
0.2913 |
0.0291 |
0.0097 |
0.0122 |
|
8 |
Vitória, Brazil |
admixed |
Genetic... |
242 |
0.0024 |
0.0050 |
0.3665 |
0.1746 |
0.3766 |
0.0474 |
0.0150 |
0.0075 |
0.0050 |
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.
References
- Asamura H, Sakai H, Kobayashi K, Ota M, Fukushima H (2006) MiniX-STR multiplex system population st...
- Edelmann J, Deichsel D, Hering S, Plate I, Szibor R (2002) Sequence variation and allele nomenclatu...
- Edelmann J, Szibor R (2003) The X-linked STRs DXS7130 and DXS6803. Forensic Science International 1...
- Gu SZ, Li SB (2006) X-chromosome STRs analysis of Ewenke ethnic population. Forensic Science Intern...
- Kang LL, Li SB (2006) X-chromosome STR polymorphism of Luoba Ethnic Group living in Tibet (SW China...
- Liu QB, Li SB (2006) Patterns of genetic polymorphism at the 10 X-chromosome STR loci in Mongol pop...
- Poetsch M, El-Mostaqim D, Tschentscher F, Browne E, Timmann C, Horstmann R, von Wurmb-Schwark N (20...
- Poetsch M, Petersmann H, Repenning A, Lignitz E (2005) Development of two pentaplex systems with X-...
- Poetsch M, Sabule A, Petersmann H, Volksone V, Lignitz E (2006) Population data of 10 X-chromosomal...
- Robino C, Giolitti A, Gino S, Torre C (2006) Development of two multiplex PCR systems for the analy...
- Rodrigues EMR, Leite FPDN, Hutz MH, Palha TDBF, dos Santos AKCR, dos Santos SEB (2008) A multiplex ...
- Shi MS, Deng JQ, Ying BW, Hou YP, Yan J, Li YB, Wu J, Tang JP, Ji Q (2003) Two X-chromosome STR loc...
- Son JY, Lee YS, Choung CM, Lee SD (2002) Polymorphism of nine X chromosomal STR loci in Koreans. In...
- Szibor R (2007) X-chromosomal markers: past, present and future. Forensic Sci Int Genet 1:93-99
- Szibor R, Edelmann J, Hering S, Plate I, Wittig H, Roewer L, Wiegand P, Cali F, Romano V, Michael M...
- Szibor R, Krawczak M, Hering S, Edelmann J, Kuhlisch E, Krause D (2003) Use of X-linked markers for...
- Turrina S, Atzei R, Filippini G, De Leo D (2007) Development and forensic validation of a new multi...
- Turrina S, De Leo D (2003) Population data of three X-chromosomal STRs: DXS7132, DXS7133 and GATA17...
- Yu B, Zhang HB, Li SB (2005) X-chromosome STRs polymorphisms of Han ethnic group from Northwest Chi...
- Turrina S, De Leo D (2004) Population genetic comparisons of three X-chromosomal STRs (DXS7132, DXS...
NoteNo data.
|
![](/xdb/skins/img/ajaxProcess.gif;jsessionid=C21638598FFD3160C29AEFD3D121691A) |
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif)
News
Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.
|
![](/xdb/a4j/g/3_3_0.GAimages/spacer.gif) |